Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124877279:

Variant ID: vg1124877279 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 24877279
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:

AAGACAAGGATTATACTGGTTCAGGCCCCTTGCTAGGTAATAGCCCTAATCCAGTTGGTATGGGATTATATGATGAAAACCACAGATTACAAAGGAATAG[T/C]
AGAACTCGATGATACCGACAAGATCGTAGTCGAGTTGGTCCGACTAGATCTCCCGGCGACTTGGCTCCTGCGCGCTTCGGCTCCGCAGGCTGTGGTGGGT

Reverse complement sequence

ACCCACCACAGCCTGCGGAGCCGAAGCGCGCAGGAGCCAAGTCGCCGGGAGATCTAGTCGGACCAACTCGACTACGATCTTGTCGGTATCATCGAGTTCT[A/G]
CTATTCCTTTGTAATCTGTGGTTTTCATCATATAATCCCATACCAACTGGATTAGGGCTATTACCTAGCAAGGGGCCTGAACCAGTATAATCCTTGTCTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.50%	5.90%	1.59%	0.00%	NA
All Indica	2759	99.60%	0.30%	0.11%	0.00%	NA
All Japonica	1512	78.30%	17.10%	4.63%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	99.80%	0.00%	0.17%	0.00%	NA
Indica II	465	98.70%	1.10%	0.22%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.50%	0.40%	0.13%	0.00%	NA
Temperate Japonica	767	60.50%	30.40%	9.13%	0.00%	NA
Tropical Japonica	504	99.00%	1.00%	0.00%	0.00%	NA
Japonica Intermediate	241	91.70%	8.30%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	87.80%	10.00%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1124877279	T -> C	LOC_Os11g41470.1	upstream_gene_variant ; 254.0bp to feature; MODIFIER	silent_mutation	Average:53.06; most accessible tissue: Zhenshan97 flag leaf, score: 76.061	N	N	N	N
vg1124877279	T -> C	LOC_Os11g41480.1	upstream_gene_variant ; 2575.0bp to feature; MODIFIER	silent_mutation	Average:53.06; most accessible tissue: Zhenshan97 flag leaf, score: 76.061	N	N	N	N
vg1124877279	T -> C	LOC_Os11g41460.1	downstream_gene_variant ; 4134.0bp to feature; MODIFIER	silent_mutation	Average:53.06; most accessible tissue: Zhenshan97 flag leaf, score: 76.061	N	N	N	N
vg1124877279	T -> C	LOC_Os11g41470-LOC_Os11g41480	intergenic_region ; MODIFIER	silent_mutation	Average:53.06; most accessible tissue: Zhenshan97 flag leaf, score: 76.061	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1124877279	4.60E-08	NA	mr1238	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124877279	4.10E-06	4.42E-06	mr1238	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124877279	4.77E-10	NA	mr1309	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124877279	2.01E-07	6.17E-07	mr1309	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124877279	6.04E-06	NA	mr1609	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124877279	3.30E-08	NA	mr1841	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124877279	6.56E-06	NA	mr1841	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124877279	1.79E-07	NA	mr1900	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124877279	1.13E-06	6.47E-07	mr1900	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124877279	5.34E-08	NA	mr1238_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124877279	8.33E-07	NA	mr1238_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124877279	3.60E-07	NA	mr1484_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124877279	1.31E-09	NA	mr1609_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124877279	1.19E-08	1.19E-08	mr1609_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124877279	8.83E-10	NA	mr1841_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124877279	6.79E-08	NA	mr1841_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124877279	8.45E-09	NA	mr1900_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124877279	1.94E-07	5.85E-06	mr1900_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251