\
| Variant ID: vg1124874824 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 24874824 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 268. )
CCTACCAACGTCCGTCCGCCGGTGTGTGACCCGCAGATCCCTTCATGTATGTCCAGGAGGAGATGTTTGCCGTCATCAGATGAGATGCATTTGAGAAGTA[G/C]
TCCGTTTGGTGCCTTTTTGTACAAATCGTTGCCGATCATGCAATATATCTTGGCTTGTCGGGTTATCTTCTCAGCTTCTGCATCGTCCTCGGGCAACTCG
CGAGTTGCCCGAGGACGATGCAGAAGCTGAGAAGATAACCCGACAAGCCAAGATATATTGCATGATCGGCAACGATTTGTACAAAAAGGCACCAAACGGA[C/G]
TACTTCTCAAATGCATCTCATCTGATGACGGCAAACATCTCCTCCTGGACATACATGAAGGGATCTGCGGGTCACACACCGGCGGACGGACGTTGGTAGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.70% | 5.80% | 1.50% | 0.00% | NA |
| All Indica | 2759 | 99.60% | 0.40% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 78.90% | 16.70% | 4.43% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.50% | 0.40% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 61.70% | 29.60% | 8.74% | 0.00% | NA |
| Tropical Japonica | 504 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 8.90% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1124874824 | G -> C | LOC_Os11g41470.1 | missense_variant ; p.Leu500Val; MODERATE | nonsynonymous_codon ; L500V | Average:47.87; most accessible tissue: Minghui63 young leaf, score: 63.571 | benign |
-0.482 |
TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1124874824 | 1.13E-07 | NA | mr1238 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124874824 | 8.48E-06 | NA | mr1238 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124874824 | 6.28E-10 | NA | mr1309 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124874824 | 2.55E-07 | 5.31E-06 | mr1309 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124874824 | 1.03E-06 | NA | mr1841 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124874824 | 1.89E-07 | NA | mr1900 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124874824 | 5.51E-06 | NA | mr1900 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124874824 | 6.90E-07 | NA | mr1238_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124874824 | 3.55E-06 | NA | mr1238_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124874824 | 4.43E-06 | NA | mr1484_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124874824 | 5.44E-09 | NA | mr1609_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124874824 | 2.85E-07 | 2.85E-07 | mr1609_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124874824 | 2.19E-08 | NA | mr1841_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124874824 | 3.48E-07 | NA | mr1841_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124874824 | 6.96E-08 | NA | mr1900_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124874824 | 9.07E-07 | NA | mr1900_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |