\
| Variant ID: vg1124874746 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 24874746 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 277. )
CAGGCTTCACACCGCTGCACCATGTCGCAGGCGTCTTTGAGCGCGGTCGGCCAGAAAAACCCTTGTCGAAAAGCTTTTCCTACCAACGTCCGTCCGCCGG[T/C]
GTGTGACCCGCAGATCCCTTCATGTATGTCCAGGAGGAGATGTTTGCCGTCATCAGATGAGATGCATTTGAGAAGTAGTCCGTTTGGTGCCTTTTTGTAC
GTACAAAAAGGCACCAAACGGACTACTTCTCAAATGCATCTCATCTGATGACGGCAAACATCTCCTCCTGGACATACATGAAGGGATCTGCGGGTCACAC[A/G]
CCGGCGGACGGACGTTGGTAGGAAAAGCTTTTCGACAAGGGTTTTTCTGGCCGACCGCGCTCAAAGACGCCTGCGACATGGTGCAGCGGTGTGAAGCCTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.40% | 13.50% | 0.30% | 0.72% | NA |
| All Indica | 2759 | 99.20% | 0.70% | 0.00% | 0.07% | NA |
| All Japonica | 1512 | 57.00% | 40.00% | 0.86% | 2.12% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.30% | 1.40% | 0.00% | 0.25% | NA |
| Temperate Japonica | 767 | 21.10% | 73.10% | 1.69% | 4.04% | NA |
| Tropical Japonica | 504 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 85.90% | 13.70% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 85.60% | 13.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1124874746 | T -> DEL | LOC_Os11g41470.1 | N | frameshift_variant | Average:48.391; most accessible tissue: Minghui63 young leaf, score: 65.92 | N | N | N | N |
| vg1124874746 | T -> C | LOC_Os11g41470.1 | missense_variant ; p.Thr526Ala; MODERATE | nonsynonymous_codon ; T526A | Average:48.391; most accessible tissue: Minghui63 young leaf, score: 65.92 | benign |
-0.781 |
TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1124874746 | NA | 1.21E-11 | mr1650 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124874746 | NA | 3.37E-06 | mr1657 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124874746 | NA | 1.21E-10 | mr1959 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124874746 | 8.69E-07 | 8.68E-07 | mr1036_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124874746 | NA | 2.99E-07 | mr1042_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124874746 | NA | 3.18E-06 | mr1153_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124874746 | NA | 2.99E-32 | mr1310_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124874746 | NA | 9.85E-08 | mr1310_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124874746 | NA | 6.21E-07 | mr1347_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124874746 | NA | 2.76E-06 | mr1398_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124874746 | NA | 3.12E-09 | mr1543_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124874746 | NA | 1.95E-08 | mr1582_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124874746 | NA | 2.43E-09 | mr1742_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124874746 | NA | 4.87E-09 | mr1871_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124874746 | NA | 1.08E-15 | mr1959_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124874746 | NA | 3.12E-06 | mr1959_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124874746 | NA | 5.74E-07 | mr1966_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |