\
| Variant ID: vg1124866431 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 24866431 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TCTCTGAGCAAGGCAAGTCACATCATCCTTGAGCATATTGAATCCCAGCTTATAAAATTATTTTGATTTAAATTATTGCATTATCGCTTTATTTAAATTC[T/C]
TGCGTTATCACTGTTTTATTTAGCCATGCCTATTTACCTTTGTTATGACATTATTATTGCTATTGTTATTATTACCTTGTTCACCCTAGAATAAATAAAA
TTTTATTTATTCTAGGGTGAACAAGGTAATAATAACAATAGCAATAATAATGTCATAACAAAGGTAAATAGGCATGGCTAAATAAAACAGTGATAACGCA[A/G]
GAATTTAAATAAAGCGATAATGCAATAATTTAAATCAAAATAATTTTATAAGCTGGGATTCAATATGCTCAAGGATGATGTGACTTGCCTTGCTCAGAGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.70% | 14.90% | 0.42% | 16.99% | NA |
| All Indica | 2759 | 96.00% | 1.10% | 0.33% | 2.54% | NA |
| All Japonica | 1512 | 20.80% | 43.10% | 0.20% | 35.91% | NA |
| Aus | 269 | 50.90% | 0.70% | 2.97% | 45.35% | NA |
| Indica I | 595 | 99.00% | 0.50% | 0.34% | 0.17% | NA |
| Indica II | 465 | 96.10% | 2.40% | 0.22% | 1.29% | NA |
| Indica III | 913 | 95.10% | 0.10% | 0.44% | 4.38% | NA |
| Indica Intermediate | 786 | 94.80% | 2.00% | 0.25% | 2.93% | NA |
| Temperate Japonica | 767 | 9.10% | 78.90% | 0.13% | 11.86% | NA |
| Tropical Japonica | 504 | 33.50% | 2.40% | 0.20% | 63.89% | NA |
| Japonica Intermediate | 241 | 31.50% | 14.10% | 0.41% | 53.94% | NA |
| VI/Aromatic | 96 | 42.70% | 1.00% | 0.00% | 56.25% | NA |
| Intermediate | 90 | 64.40% | 20.00% | 0.00% | 15.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1124866431 | T -> DEL | N | N | silent_mutation | Average:13.519; most accessible tissue: Zhenshan97 flag leaf, score: 19.61 | N | N | N | N |
| vg1124866431 | T -> C | LOC_Os11g41440.1 | upstream_gene_variant ; 1078.0bp to feature; MODIFIER | silent_mutation | Average:13.519; most accessible tissue: Zhenshan97 flag leaf, score: 19.61 | N | N | N | N |
| vg1124866431 | T -> C | LOC_Os11g41460.1 | upstream_gene_variant ; 4708.0bp to feature; MODIFIER | silent_mutation | Average:13.519; most accessible tissue: Zhenshan97 flag leaf, score: 19.61 | N | N | N | N |
| vg1124866431 | T -> C | LOC_Os11g41430.1 | downstream_gene_variant ; 3124.0bp to feature; MODIFIER | silent_mutation | Average:13.519; most accessible tissue: Zhenshan97 flag leaf, score: 19.61 | N | N | N | N |
| vg1124866431 | T -> C | LOC_Os11g41450.1 | downstream_gene_variant ; 2190.0bp to feature; MODIFIER | silent_mutation | Average:13.519; most accessible tissue: Zhenshan97 flag leaf, score: 19.61 | N | N | N | N |
| vg1124866431 | T -> C | LOC_Os11g41440-LOC_Os11g41450 | intergenic_region ; MODIFIER | silent_mutation | Average:13.519; most accessible tissue: Zhenshan97 flag leaf, score: 19.61 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1124866431 | NA | 1.11E-07 | mr1042_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124866431 | NA | 7.11E-06 | mr1153_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124866431 | NA | 1.57E-08 | mr1471_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124866431 | NA | 1.73E-18 | mr1540_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124866431 | NA | 6.48E-10 | mr1543_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124866431 | 5.76E-06 | 5.76E-06 | mr1609_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124866431 | NA | 2.79E-11 | mr1722_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124866431 | NA | 1.14E-17 | mr1732_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124866431 | 2.05E-06 | NA | mr1734_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124866431 | NA | 2.49E-09 | mr1742_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124866431 | NA | 5.24E-12 | mr1879_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124866431 | NA | 8.46E-08 | mr1966_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |