\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124866431:

Variant ID: vg1124866431 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 24866431
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTCTGAGCAAGGCAAGTCACATCATCCTTGAGCATATTGAATCCCAGCTTATAAAATTATTTTGATTTAAATTATTGCATTATCGCTTTATTTAAATTC[T/C]
TGCGTTATCACTGTTTTATTTAGCCATGCCTATTTACCTTTGTTATGACATTATTATTGCTATTGTTATTATTACCTTGTTCACCCTAGAATAAATAAAA

Reverse complement sequence

TTTTATTTATTCTAGGGTGAACAAGGTAATAATAACAATAGCAATAATAATGTCATAACAAAGGTAAATAGGCATGGCTAAATAAAACAGTGATAACGCA[A/G]
GAATTTAAATAAAGCGATAATGCAATAATTTAAATCAAAATAATTTTATAAGCTGGGATTCAATATGCTCAAGGATGATGTGACTTGCCTTGCTCAGAGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.70% 14.90% 0.42% 16.99% NA
All Indica  2759 96.00% 1.10% 0.33% 2.54% NA
All Japonica  1512 20.80% 43.10% 0.20% 35.91% NA
Aus  269 50.90% 0.70% 2.97% 45.35% NA
Indica I  595 99.00% 0.50% 0.34% 0.17% NA
Indica II  465 96.10% 2.40% 0.22% 1.29% NA
Indica III  913 95.10% 0.10% 0.44% 4.38% NA
Indica Intermediate  786 94.80% 2.00% 0.25% 2.93% NA
Temperate Japonica  767 9.10% 78.90% 0.13% 11.86% NA
Tropical Japonica  504 33.50% 2.40% 0.20% 63.89% NA
Japonica Intermediate  241 31.50% 14.10% 0.41% 53.94% NA
VI/Aromatic  96 42.70% 1.00% 0.00% 56.25% NA
Intermediate  90 64.40% 20.00% 0.00% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1124866431 T -> DEL N N silent_mutation Average:13.519; most accessible tissue: Zhenshan97 flag leaf, score: 19.61 N N N N
vg1124866431 T -> C LOC_Os11g41440.1 upstream_gene_variant ; 1078.0bp to feature; MODIFIER silent_mutation Average:13.519; most accessible tissue: Zhenshan97 flag leaf, score: 19.61 N N N N
vg1124866431 T -> C LOC_Os11g41460.1 upstream_gene_variant ; 4708.0bp to feature; MODIFIER silent_mutation Average:13.519; most accessible tissue: Zhenshan97 flag leaf, score: 19.61 N N N N
vg1124866431 T -> C LOC_Os11g41430.1 downstream_gene_variant ; 3124.0bp to feature; MODIFIER silent_mutation Average:13.519; most accessible tissue: Zhenshan97 flag leaf, score: 19.61 N N N N
vg1124866431 T -> C LOC_Os11g41450.1 downstream_gene_variant ; 2190.0bp to feature; MODIFIER silent_mutation Average:13.519; most accessible tissue: Zhenshan97 flag leaf, score: 19.61 N N N N
vg1124866431 T -> C LOC_Os11g41440-LOC_Os11g41450 intergenic_region ; MODIFIER silent_mutation Average:13.519; most accessible tissue: Zhenshan97 flag leaf, score: 19.61 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1124866431 NA 1.11E-07 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124866431 NA 7.11E-06 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124866431 NA 1.57E-08 mr1471_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124866431 NA 1.73E-18 mr1540_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124866431 NA 6.48E-10 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124866431 5.76E-06 5.76E-06 mr1609_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124866431 NA 2.79E-11 mr1722_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124866431 NA 1.14E-17 mr1732_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124866431 2.05E-06 NA mr1734_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124866431 NA 2.49E-09 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124866431 NA 5.24E-12 mr1879_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124866431 NA 8.46E-08 mr1966_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251