\
| Variant ID: vg1124841437 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 24841437 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TGCTGGTGCTGGCGTGGCGTGTTAGAGCTGATGAAGCCAGTTAGCGCGTGTTGCGGCAAGATAGATAGAAACGGATTAGCCGGTTAGTTTGTTTCCTTTC[C/T]
GATTAAACTTTTCCATATTTTTGTGGGATCAATTAGGATTGTTAAAGATTGATTAGAGTGACCAGTATATATACTGGTGACGATAGATTAGAGAAGGCCC
GGGCCTTCTCTAATCTATCGTCACCAGTATATATACTGGTCACTCTAATCAATCTTTAACAATCCTAATTGATCCCACAAAAATATGGAAAAGTTTAATC[G/A]
GAAAGGAAACAAACTAACCGGCTAATCCGTTTCTATCTATCTTGCCGCAACACGCGCTAACTGGCTTCATCAGCTCTAACACGCCACGCCAGCACCAGCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.00% | 15.50% | 0.49% | 0.00% | NA |
| All Indica | 2759 | 97.50% | 2.40% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 62.80% | 37.00% | 0.20% | 0.00% | NA |
| Aus | 269 | 85.50% | 13.80% | 0.74% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 96.10% | 3.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.90% | 2.70% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 87.40% | 12.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 34.10% | 65.50% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 44.80% | 54.80% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 29.20% | 58.30% | 12.50% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 15.60% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1124841437 | C -> T | LOC_Os11g41380.1 | downstream_gene_variant ; 4645.0bp to feature; MODIFIER | silent_mutation | Average:46.103; most accessible tissue: Minghui63 flag leaf, score: 63.086 | N | N | N | N |
| vg1124841437 | C -> T | LOC_Os11g41400.1 | downstream_gene_variant ; 2601.0bp to feature; MODIFIER | silent_mutation | Average:46.103; most accessible tissue: Minghui63 flag leaf, score: 63.086 | N | N | N | N |
| vg1124841437 | C -> T | LOC_Os11g41390.1 | intron_variant ; MODIFIER | silent_mutation | Average:46.103; most accessible tissue: Minghui63 flag leaf, score: 63.086 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1124841437 | NA | 5.45E-12 | mr1609 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124841437 | NA | 5.98E-06 | mr1195_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124841437 | 6.95E-07 | NA | mr1238_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124841437 | NA | 3.13E-10 | mr1398_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124841437 | 5.03E-06 | NA | mr1484_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124841437 | NA | 3.93E-07 | mr1554_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124841437 | NA | 7.77E-08 | mr1582_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124841437 | 8.96E-07 | NA | mr1609_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124841437 | 1.20E-06 | 1.20E-06 | mr1609_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124841437 | NA | 1.92E-06 | mr1730_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124841437 | 2.44E-06 | NA | mr1841_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124841437 | 3.61E-07 | NA | mr1900_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124841437 | NA | 6.70E-06 | mr1959_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |