\
| Variant ID: vg1124840128 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 24840128 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 236. )
CGTGCCTTGCACGTGCACACTCACTAGTATTTTAAAATGGATGAGTAGATTTATAGATTTACTCCCTCCATTTCAAAATATAAGACCCGGCCACTATTAA[T/C]
GCAAAGACAAAAAAAAATATTATCACCTTTTTGTTAGGATCACCCAAATAAATAAAATGCATGCACCCAATGGGAATAGAGTTATTGAGAATGGAGGATT
AATCCTCCATTCTCAATAACTCTATTCCCATTGGGTGCATGCATTTTATTTATTTGGGTGATCCTAACAAAAAGGTGATAATATTTTTTTTTGTCTTTGC[A/G]
TTAATAGTGGCCGGGTCTTATATTTTGAAATGGAGGGAGTAAATCTATAAATCTACTCATCCATTTTAAAATACTAGTGAGTGTGCACGTGCAAGGCACG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.50% | 10.80% | 0.66% | 0.00% | NA |
| All Indica | 2759 | 92.30% | 7.60% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 79.10% | 19.10% | 1.79% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.00% | 4.90% | 0.17% | 0.00% | NA |
| Indica II | 465 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 90.80% | 9.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 88.50% | 11.20% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 64.10% | 32.30% | 3.52% | 0.00% | NA |
| Tropical Japonica | 504 | 96.80% | 3.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 89.60% | 10.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 11.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1124840128 | T -> C | LOC_Os11g41380.1 | downstream_gene_variant ; 3336.0bp to feature; MODIFIER | silent_mutation | Average:27.667; most accessible tissue: Zhenshan97 young leaf, score: 55.899 | N | N | N | N |
| vg1124840128 | T -> C | LOC_Os11g41400.1 | downstream_gene_variant ; 3910.0bp to feature; MODIFIER | silent_mutation | Average:27.667; most accessible tissue: Zhenshan97 young leaf, score: 55.899 | N | N | N | N |
| vg1124840128 | T -> C | LOC_Os11g41390.1 | intron_variant ; MODIFIER | silent_mutation | Average:27.667; most accessible tissue: Zhenshan97 young leaf, score: 55.899 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1124840128 | 8.29E-06 | NA | mr1238 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124840128 | 1.97E-07 | 3.16E-06 | mr1309 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124840128 | 2.73E-06 | NA | mr1841 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124840128 | 6.44E-06 | NA | mr1841 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124840128 | 3.20E-06 | NA | mr1900 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124840128 | 7.76E-06 | NA | mr1900 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124840128 | 5.01E-06 | NA | mr1238_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124840128 | 3.40E-07 | NA | mr1238_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124840128 | NA | 3.97E-06 | mr1533_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124840128 | 1.69E-08 | NA | mr1609_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124840128 | 3.31E-08 | 3.31E-08 | mr1609_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124840128 | 6.06E-07 | NA | mr1841_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124840128 | 9.98E-08 | NA | mr1841_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124840128 | 6.55E-07 | NA | mr1900_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124840128 | 1.58E-07 | NA | mr1900_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |