Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124834120:

Variant ID: vg1124834120 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 24834120
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.02, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

ATTTGTCCACTTGGTCACTTAGTTTCTTTATGCCTATGGCTAACCTCAACCAATTTTATGGACCTGATAATGATAGAGCTTTTTTCACCAACTACAAAAC[C/T]
TAAAAAATTTATTTCTAACGATTCTCATACAAATTAGTAGTGGGGAGAAATACCAATGACGTCCTAATAAATTCCTTTATTTTTCTAAATTCCAATTAAA

Reverse complement sequence

TTTAATTGGAATTTAGAAAAATAAAGGAATTTATTAGGACGTCATTGGTATTTCTCCCCACTACTAATTTGTATGAGAATCGTTAGAAATAAATTTTTTA[G/A]
GTTTTGTAGTTGGTGAAAAAAGCTCTATCATTATCAGGTCCATAAAATTGGTTGAGGTTAGCCATAGGCATAAAGAAACTAAGTGACCAAGTGGACAAAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.70%	49.20%	0.08%	0.00%	NA
All Indica	2759	27.50%	72.50%	0.04%	0.00%	NA
All Japonica	1512	82.30%	17.50%	0.20%	0.00%	NA
Aus	269	96.30%	3.70%	0.00%	0.00%	NA
Indica I	595	7.20%	92.80%	0.00%	0.00%	NA
Indica II	465	41.50%	58.30%	0.22%	0.00%	NA
Indica III	913	30.90%	69.10%	0.00%	0.00%	NA
Indica Intermediate	786	30.50%	69.50%	0.00%	0.00%	NA
Temperate Japonica	767	92.00%	7.80%	0.13%	0.00%	NA
Tropical Japonica	504	70.20%	29.80%	0.00%	0.00%	NA
Japonica Intermediate	241	76.80%	22.40%	0.83%	0.00%	NA
VI/Aromatic	96	90.60%	9.40%	0.00%	0.00%	NA
Intermediate	90	51.10%	48.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1124834120	C -> T	LOC_Os11g41365.1	upstream_gene_variant ; 4923.0bp to feature; MODIFIER	silent_mutation	Average:38.894; most accessible tissue: Zhenshan97 young leaf, score: 59.009	N	N	N	N
vg1124834120	C -> T	LOC_Os11g41390.1	upstream_gene_variant ; 4221.0bp to feature; MODIFIER	silent_mutation	Average:38.894; most accessible tissue: Zhenshan97 young leaf, score: 59.009	N	N	N	N
vg1124834120	C -> T	LOC_Os11g41370.1	downstream_gene_variant ; 3027.0bp to feature; MODIFIER	silent_mutation	Average:38.894; most accessible tissue: Zhenshan97 young leaf, score: 59.009	N	N	N	N
vg1124834120	C -> T	LOC_Os11g41380.1	intron_variant ; MODIFIER	silent_mutation	Average:38.894; most accessible tissue: Zhenshan97 young leaf, score: 59.009	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1124834120	NA	1.81E-07	mr1720	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124834120	NA	5.40E-06	mr1749	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124834120	NA	1.55E-06	mr1310_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124834120	NA	1.37E-06	mr1551_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124834120	NA	2.54E-08	mr1552_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124834120	NA	1.29E-06	mr1607_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124834120	NA	1.67E-06	mr1733_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124834120	NA	1.23E-06	mr1951_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251