\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124829861:

Variant ID: vg1124829861 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 24829861
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 127. )

Flanking Sequence (100 bp) in Reference Genome:


GGTCAATCGGACGAGCGGTTGAGGAGATATGGATTTCCTAAGATTATTTGGATTTTCTGTCTAAAGGAAAAGGATTTATCAAATCCTTTGGAAAAGAAAA[G/A]
GAAGGAGGGATGTCATTTAGACTTACTCGGGTGGCTTTAGGCGCGGCCCAAGGGGTCATGCGCAGCGCGGGTGGTCGGCCCATTAGGGGCGCGCGGGAGG

Reverse complement sequence

CCTCCCGCGCGCCCCTAATGGGCCGACCACCCGCGCTGCGCATGACCCCTTGGGCCGCGCCTAAAGCCACCCGAGTAAGTCTAAATGACATCCCTCCTTC[C/T]
TTTTCTTTTCCAAAGGATTTGATAAATCCTTTTCCTTTAGACAGAAAATCCAAATAATCTTAGGAAATCCATATCTCCTCAACCGCTCGTCCGATTGACC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.00% 5.00% 0.02% 0.00% NA
All Indica  2759 91.50% 8.40% 0.04% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 98.50% 1.50% 0.00% 0.00% NA
Indica II  465 66.00% 33.80% 0.22% 0.00% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 91.90% 8.10% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1124829861 G -> A LOC_Os11g41365.1 upstream_gene_variant ; 664.0bp to feature; MODIFIER silent_mutation Average:57.272; most accessible tissue: Minghui63 young leaf, score: 76.385 N N N N
vg1124829861 G -> A LOC_Os11g41370.1 upstream_gene_variant ; 379.0bp to feature; MODIFIER silent_mutation Average:57.272; most accessible tissue: Minghui63 young leaf, score: 76.385 N N N N
vg1124829861 G -> A LOC_Os11g41380.1 upstream_gene_variant ; 3245.0bp to feature; MODIFIER silent_mutation Average:57.272; most accessible tissue: Minghui63 young leaf, score: 76.385 N N N N
vg1124829861 G -> A LOC_Os11g41365-LOC_Os11g41370 intergenic_region ; MODIFIER silent_mutation Average:57.272; most accessible tissue: Minghui63 young leaf, score: 76.385 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1124829861 NA 7.28E-06 mr1122 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124829861 NA 6.58E-06 mr1377 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124829861 NA 7.69E-06 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124829861 NA 1.18E-07 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124829861 NA 7.57E-11 mr1720 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124829861 NA 2.69E-09 mr1720 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124829861 NA 2.31E-09 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124829861 NA 3.80E-08 mr1903 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124829861 NA 3.01E-07 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124829861 NA 9.13E-07 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251