Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124829861:

Variant ID: vg1124829861 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 24829861
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 127. )

Flanking Sequence (100 bp) in Reference Genome:

GGTCAATCGGACGAGCGGTTGAGGAGATATGGATTTCCTAAGATTATTTGGATTTTCTGTCTAAAGGAAAAGGATTTATCAAATCCTTTGGAAAAGAAAA[G/A]
GAAGGAGGGATGTCATTTAGACTTACTCGGGTGGCTTTAGGCGCGGCCCAAGGGGTCATGCGCAGCGCGGGTGGTCGGCCCATTAGGGGCGCGCGGGAGG

Reverse complement sequence

CCTCCCGCGCGCCCCTAATGGGCCGACCACCCGCGCTGCGCATGACCCCTTGGGCCGCGCCTAAAGCCACCCGAGTAAGTCTAAATGACATCCCTCCTTC[C/T]
TTTTCTTTTCCAAAGGATTTGATAAATCCTTTTCCTTTAGACAGAAAATCCAAATAATCTTAGGAAATCCATATCTCCTCAACCGCTCGTCCGATTGACC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.00%	5.00%	0.02%	0.00%	NA
All Indica	2759	91.50%	8.40%	0.04%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	98.50%	1.50%	0.00%	0.00%	NA
Indica II	465	66.00%	33.80%	0.22%	0.00%	NA
Indica III	913	99.70%	0.30%	0.00%	0.00%	NA
Indica Intermediate	786	91.90%	8.10%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	97.80%	2.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1124829861	G -> A	LOC_Os11g41365.1	upstream_gene_variant ; 664.0bp to feature; MODIFIER	silent_mutation	Average:57.272; most accessible tissue: Minghui63 young leaf, score: 76.385	N	N	N	N
vg1124829861	G -> A	LOC_Os11g41370.1	upstream_gene_variant ; 379.0bp to feature; MODIFIER	silent_mutation	Average:57.272; most accessible tissue: Minghui63 young leaf, score: 76.385	N	N	N	N
vg1124829861	G -> A	LOC_Os11g41380.1	upstream_gene_variant ; 3245.0bp to feature; MODIFIER	silent_mutation	Average:57.272; most accessible tissue: Minghui63 young leaf, score: 76.385	N	N	N	N
vg1124829861	G -> A	LOC_Os11g41365-LOC_Os11g41370	intergenic_region ; MODIFIER	silent_mutation	Average:57.272; most accessible tissue: Minghui63 young leaf, score: 76.385	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1124829861	NA	7.28E-06	mr1122	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124829861	NA	6.58E-06	mr1377	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124829861	NA	7.69E-06	mr1432	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124829861	NA	1.18E-07	mr1498	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124829861	NA	7.57E-11	mr1720	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124829861	NA	2.69E-09	mr1720	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124829861	NA	2.31E-09	mr1769	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124829861	NA	3.80E-08	mr1903	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124829861	NA	3.01E-07	mr1951	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124829861	NA	9.13E-07	mr1498_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251