\
| Variant ID: vg1124829861 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 24829861 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 127. )
GGTCAATCGGACGAGCGGTTGAGGAGATATGGATTTCCTAAGATTATTTGGATTTTCTGTCTAAAGGAAAAGGATTTATCAAATCCTTTGGAAAAGAAAA[G/A]
GAAGGAGGGATGTCATTTAGACTTACTCGGGTGGCTTTAGGCGCGGCCCAAGGGGTCATGCGCAGCGCGGGTGGTCGGCCCATTAGGGGCGCGCGGGAGG
CCTCCCGCGCGCCCCTAATGGGCCGACCACCCGCGCTGCGCATGACCCCTTGGGCCGCGCCTAAAGCCACCCGAGTAAGTCTAAATGACATCCCTCCTTC[C/T]
TTTTCTTTTCCAAAGGATTTGATAAATCCTTTTCCTTTAGACAGAAAATCCAAATAATCTTAGGAAATCCATATCTCCTCAACCGCTCGTCCGATTGACC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.00% | 5.00% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 91.50% | 8.40% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 66.00% | 33.80% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 91.90% | 8.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1124829861 | G -> A | LOC_Os11g41365.1 | upstream_gene_variant ; 664.0bp to feature; MODIFIER | silent_mutation | Average:57.272; most accessible tissue: Minghui63 young leaf, score: 76.385 | N | N | N | N |
| vg1124829861 | G -> A | LOC_Os11g41370.1 | upstream_gene_variant ; 379.0bp to feature; MODIFIER | silent_mutation | Average:57.272; most accessible tissue: Minghui63 young leaf, score: 76.385 | N | N | N | N |
| vg1124829861 | G -> A | LOC_Os11g41380.1 | upstream_gene_variant ; 3245.0bp to feature; MODIFIER | silent_mutation | Average:57.272; most accessible tissue: Minghui63 young leaf, score: 76.385 | N | N | N | N |
| vg1124829861 | G -> A | LOC_Os11g41365-LOC_Os11g41370 | intergenic_region ; MODIFIER | silent_mutation | Average:57.272; most accessible tissue: Minghui63 young leaf, score: 76.385 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1124829861 | NA | 7.28E-06 | mr1122 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124829861 | NA | 6.58E-06 | mr1377 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124829861 | NA | 7.69E-06 | mr1432 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124829861 | NA | 1.18E-07 | mr1498 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124829861 | NA | 7.57E-11 | mr1720 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124829861 | NA | 2.69E-09 | mr1720 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124829861 | NA | 2.31E-09 | mr1769 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124829861 | NA | 3.80E-08 | mr1903 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124829861 | NA | 3.01E-07 | mr1951 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124829861 | NA | 9.13E-07 | mr1498_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |