\
| Variant ID: vg1124807320 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 24807320 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTATTTCTTTGTACTACACTATTAAAAAACGATTTTTCATGATGTTACCTGATCATTTTCGTTGGCGGACATAAGTGAAAACCACCCGCAACAACGTAAC[A/G]
AGGGGTGGGCCGAGAGACTTTAGATTGCTAGCGAAAACTGATCTTGTCTAACCGGGCCACTATTGAAGATGTTGTAGTTATTGCTGGAGCCACACATAAG
CTTATGTGTGGCTCCAGCAATAACTACAACATCTTCAATAGTGGCCCGGTTAGACAAGATCAGTTTTCGCTAGCAATCTAAAGTCTCTCGGCCCACCCCT[T/C]
GTTACGTTGTTGCGGGTGGTTTTCACTTATGTCCGCCAACGAAAATGATCAGGTAACATCATGAAAAATCGTTTTTTAATAGTGTAGTACAAAGAAATAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.60% | 9.40% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 71.40% | 28.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 54.50% | 45.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 95.00% | 5.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 75.90% | 24.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1124807320 | A -> G | LOC_Os11g41350.1 | downstream_gene_variant ; 2320.0bp to feature; MODIFIER | silent_mutation | Average:49.818; most accessible tissue: Callus, score: 76.628 | N | N | N | N |
| vg1124807320 | A -> G | LOC_Os11g41330-LOC_Os11g41350 | intergenic_region ; MODIFIER | silent_mutation | Average:49.818; most accessible tissue: Callus, score: 76.628 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1124807320 | 9.50E-07 | NA | mr1238 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124807320 | NA | 6.83E-06 | mr1555 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124807320 | 1.08E-07 | NA | mr1238_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124807320 | 1.30E-07 | NA | mr1484_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124807320 | NA | 2.66E-07 | mr1629_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124807320 | 4.05E-08 | NA | mr1841_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124807320 | 1.89E-06 | NA | mr1900_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124807320 | 2.21E-08 | NA | mr1945_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |