\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124807320:

Variant ID: vg1124807320 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 24807320
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTATTTCTTTGTACTACACTATTAAAAAACGATTTTTCATGATGTTACCTGATCATTTTCGTTGGCGGACATAAGTGAAAACCACCCGCAACAACGTAAC[A/G]
AGGGGTGGGCCGAGAGACTTTAGATTGCTAGCGAAAACTGATCTTGTCTAACCGGGCCACTATTGAAGATGTTGTAGTTATTGCTGGAGCCACACATAAG

Reverse complement sequence

CTTATGTGTGGCTCCAGCAATAACTACAACATCTTCAATAGTGGCCCGGTTAGACAAGATCAGTTTTCGCTAGCAATCTAAAGTCTCTCGGCCCACCCCT[T/C]
GTTACGTTGTTGCGGGTGGTTTTCACTTATGTCCGCCAACGAAAATGATCAGGTAACATCATGAAAAATCGTTTTTTAATAGTGTAGTACAAAGAAATAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.60% 9.40% 0.00% 0.00% NA
All Indica  2759 99.80% 0.20% 0.00% 0.00% NA
All Japonica  1512 71.40% 28.60% 0.00% 0.00% NA
Aus  269 98.10% 1.90% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.50% 0.50% 0.00% 0.00% NA
Temperate Japonica  767 54.50% 45.50% 0.00% 0.00% NA
Tropical Japonica  504 95.00% 5.00% 0.00% 0.00% NA
Japonica Intermediate  241 75.90% 24.10% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1124807320 A -> G LOC_Os11g41350.1 downstream_gene_variant ; 2320.0bp to feature; MODIFIER silent_mutation Average:49.818; most accessible tissue: Callus, score: 76.628 N N N N
vg1124807320 A -> G LOC_Os11g41330-LOC_Os11g41350 intergenic_region ; MODIFIER silent_mutation Average:49.818; most accessible tissue: Callus, score: 76.628 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1124807320 9.50E-07 NA mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124807320 NA 6.83E-06 mr1555 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124807320 1.08E-07 NA mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124807320 1.30E-07 NA mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124807320 NA 2.66E-07 mr1629_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124807320 4.05E-08 NA mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124807320 1.89E-06 NA mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124807320 2.21E-08 NA mr1945_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251