Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1124763144:

Variant ID: vg1124763144 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 24763144
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCTACATCATCTACATGGTGTCAAGAGCGTCGGTTCCGCAGTTTGGCCTTCGGGAACGGGAGACTTCAGCTGGTGCTACTTCACCTTCTTCACATGGATC[A/G]
TTTCTGTGGAGAACTTTCCTGGAGGAGACAACATCCCTGCACGGCCGCTCCGCGTTGCCAGACGACCAACCTTTTGCATTTCCACCGTGCTGAATTATAT

Reverse complement sequence

ATATAATTCAGCACGGTGGAAATGCAAAAGGTTGGTCGTCTGGCAACGCGGAGCGGCCGTGCAGGGATGTTGTCTCCTCCAGGAAAGTTCTCCACAGAAA[T/C]
GATCCATGTGAAGAAGGTGAAGTAGCACCAGCTGAAGTCTCCCGTTCCCGAAGGCCAAACTGCGGAACCGACGCTCTTGACACCATGTAGATGATGTAGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.10% 16.90% 0.02% 0.00% NA
All Indica  2759 98.70% 1.30% 0.00% 0.00% NA
All Japonica  1512 50.80% 49.10% 0.07% 0.00% NA
Aus  269 98.50% 1.50% 0.00% 0.00% NA
Indica I  595 99.20% 0.80% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 99.60% 0.40% 0.00% 0.00% NA
Indica Intermediate  786 96.70% 3.30% 0.00% 0.00% NA
Temperate Japonica  767 18.30% 81.60% 0.13% 0.00% NA
Tropical Japonica  504 94.60% 5.40% 0.00% 0.00% NA
Japonica Intermediate  241 62.70% 37.30% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 86.70% 13.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1124763144 A -> G LOC_Os11g41310.1 downstream_gene_variant ; 3290.0bp to feature; MODIFIER silent_mutation Average:49.985; most accessible tissue: Zhenshan97 young leaf, score: 86.055 N N N N
vg1124763144 A -> G LOC_Os11g41310-LOC_Os11g41320 intergenic_region ; MODIFIER silent_mutation Average:49.985; most accessible tissue: Zhenshan97 young leaf, score: 86.055 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1124763144 NA 1.99E-12 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124763144 NA 5.48E-13 mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124763144 NA 1.45E-10 mr1539 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124763144 NA 1.86E-07 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124763144 NA 7.21E-30 mr1789 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124763144 NA 7.04E-10 mr1790 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124763144 NA 3.40E-07 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124763144 NA 5.62E-06 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124763144 NA 2.28E-16 mr1879 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124763144 NA 1.16E-07 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124763144 NA 1.96E-10 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124763144 NA 8.84E-07 mr1257_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124763144 NA 2.53E-32 mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124763144 NA 2.99E-07 mr1423_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124763144 NA 1.90E-08 mr1599_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124763144 NA 2.56E-11 mr1879_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124763144 NA 1.69E-14 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251