\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124667824:

Variant ID: vg1124667824 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 24667824
Reference Allele: GAlternative Allele: T
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:


TGGCTAACCCTGCATCTGCAATTGTAATCAAGGTACCTATTTAATAGTGACTGCTCATTAGAACGATATTCTGTTGATGATACACATGGGACTTCAAACG[G/T]
TGACTTTTGATTATTTCCAGGTAAAGCGGATTAGTTAGTTAGTCATGTTAGCAGTTGCTGGTGGAACTAGACTTTAAATTTATTTTTCATTTATAAGTTT

Reverse complement sequence

AAACTTATAAATGAAAAATAAATTTAAAGTCTAGTTCCACCAGCAACTGCTAACATGACTAACTAACTAATCCGCTTTACCTGGAAATAATCAAAAGTCA[C/A]
CGTTTGAAGTCCCATGTGTATCATCAACAGAATATCGTTCTAATGAGCAGTCACTATTAAATAGGTACCTTGATTACAATTGCAGATGCAGGGTTAGCCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.90% 24.40% 4.06% 24.61% NA
All Indica  2759 50.20% 4.70% 6.05% 39.04% NA
All Japonica  1512 32.40% 63.70% 0.86% 3.04% NA
Aus  269 87.00% 4.50% 1.49% 7.06% NA
Indica I  595 55.50% 3.40% 10.76% 30.42% NA
Indica II  465 50.10% 2.20% 7.96% 39.78% NA
Indica III  913 43.20% 5.60% 2.96% 48.30% NA
Indica Intermediate  786 54.30% 6.40% 4.96% 34.35% NA
Temperate Japonica  767 12.90% 84.40% 0.65% 2.09% NA
Tropical Japonica  504 56.70% 37.70% 1.39% 4.17% NA
Japonica Intermediate  241 43.60% 52.30% 0.41% 3.73% NA
VI/Aromatic  96 67.70% 27.10% 2.08% 3.12% NA
Intermediate  90 48.90% 24.40% 6.67% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1124667824 G -> T LOC_Os11g41170.1 upstream_gene_variant ; 3143.0bp to feature; MODIFIER silent_mutation Average:67.622; most accessible tissue: Callus, score: 86.571 N N N N
vg1124667824 G -> T LOC_Os11g41160-LOC_Os11g41170 intergenic_region ; MODIFIER silent_mutation Average:67.622; most accessible tissue: Callus, score: 86.571 N N N N
vg1124667824 G -> DEL N N silent_mutation Average:67.622; most accessible tissue: Callus, score: 86.571 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1124667824 NA 4.34E-06 mr1790 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124667824 NA 9.34E-06 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124667824 NA 2.83E-09 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124667824 5.98E-06 6.06E-06 mr1201_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124667824 1.03E-06 2.64E-07 mr1219_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124667824 NA 1.65E-07 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251