Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124667824:

Variant ID: vg1124667824 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 24667824
Reference Allele: G	Alternative Allele: T
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:

TGGCTAACCCTGCATCTGCAATTGTAATCAAGGTACCTATTTAATAGTGACTGCTCATTAGAACGATATTCTGTTGATGATACACATGGGACTTCAAACG[G/T]
TGACTTTTGATTATTTCCAGGTAAAGCGGATTAGTTAGTTAGTCATGTTAGCAGTTGCTGGTGGAACTAGACTTTAAATTTATTTTTCATTTATAAGTTT

Reverse complement sequence

AAACTTATAAATGAAAAATAAATTTAAAGTCTAGTTCCACCAGCAACTGCTAACATGACTAACTAACTAATCCGCTTTACCTGGAAATAATCAAAAGTCA[C/A]
CGTTTGAAGTCCCATGTGTATCATCAACAGAATATCGTTCTAATGAGCAGTCACTATTAAATAGGTACCTTGATTACAATTGCAGATGCAGGGTTAGCCA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	46.90%	24.40%	4.06%	24.61%	NA
All Indica	2759	50.20%	4.70%	6.05%	39.04%	NA
All Japonica	1512	32.40%	63.70%	0.86%	3.04%	NA
Aus	269	87.00%	4.50%	1.49%	7.06%	NA
Indica I	595	55.50%	3.40%	10.76%	30.42%	NA
Indica II	465	50.10%	2.20%	7.96%	39.78%	NA
Indica III	913	43.20%	5.60%	2.96%	48.30%	NA
Indica Intermediate	786	54.30%	6.40%	4.96%	34.35%	NA
Temperate Japonica	767	12.90%	84.40%	0.65%	2.09%	NA
Tropical Japonica	504	56.70%	37.70%	1.39%	4.17%	NA
Japonica Intermediate	241	43.60%	52.30%	0.41%	3.73%	NA
VI/Aromatic	96	67.70%	27.10%	2.08%	3.12%	NA
Intermediate	90	48.90%	24.40%	6.67%	20.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1124667824	G -> T	LOC_Os11g41170.1	upstream_gene_variant ; 3143.0bp to feature; MODIFIER	silent_mutation	Average:67.622; most accessible tissue: Callus, score: 86.571	N	N	N	N
vg1124667824	G -> T	LOC_Os11g41160-LOC_Os11g41170	intergenic_region ; MODIFIER	silent_mutation	Average:67.622; most accessible tissue: Callus, score: 86.571	N	N	N	N
vg1124667824	G -> DEL	N	N	silent_mutation	Average:67.622; most accessible tissue: Callus, score: 86.571	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1124667824	NA	4.34E-06	mr1790	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124667824	NA	9.34E-06	mr1871	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124667824	NA	2.83E-09	mr1959	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124667824	5.98E-06	6.06E-06	mr1201_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124667824	1.03E-06	2.64E-07	mr1219_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124667824	NA	1.65E-07	mr1248_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251