Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1124652420:

Variant ID: vg1124652420 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 24652420
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGAGCCGCCGCCCGGAGCAGCGTGCACCTTGGTTGACGGCCGATCCTGCATAGTCTCACCACAATCAGTGTTCAACAACATCAGCATCCAGAAATTGTAC[A/C]
TTCATATATCAGAATCACAATCTTTATTTCACTCGAAAGATTGGAGAAAATTGGTTCAGAAAAAAAAATCATGCCTAGAACATCAGCAAGTTCCATTTGC

Reverse complement sequence

GCAAATGGAACTTGCTGATGTTCTAGGCATGATTTTTTTTTCTGAACCAATTTTCTCCAATCTTTCGAGTGAAATAAAGATTGTGATTCTGATATATGAA[T/G]
GTACAATTTCTGGATGCTGATGTTGTTGAACACTGATTGTGGTGAGACTATGCAGGATCGGCCGTCAACCAAGGTGCACGCTGCTCCGGGCGGCGGCTCG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.50%	7.50%	0.00%	0.00%	NA
All Indica	2759	99.60%	0.40%	0.00%	0.00%	NA
All Japonica	1512	79.40%	20.60%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	98.70%	1.30%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.40%	0.60%	0.00%	0.00%	NA
Temperate Japonica	767	81.50%	18.50%	0.00%	0.00%	NA
Tropical Japonica	504	73.40%	26.60%	0.00%	0.00%	NA
Japonica Intermediate	241	85.10%	14.90%	0.00%	0.00%	NA
VI/Aromatic	96	82.30%	17.70%	0.00%	0.00%	NA
Intermediate	90	84.40%	15.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1124652420	A -> C	LOC_Os11g41140.1	downstream_gene_variant ; 623.0bp to feature; MODIFIER	silent_mutation	Average:56.758; most accessible tissue: Zhenshan97 root, score: 81.351	N	N	N	N
vg1124652420	A -> C	LOC_Os11g41160.1	downstream_gene_variant ; 3385.0bp to feature; MODIFIER	silent_mutation	Average:56.758; most accessible tissue: Zhenshan97 root, score: 81.351	N	N	N	N
vg1124652420	A -> C	LOC_Os11g41160.2	downstream_gene_variant ; 3385.0bp to feature; MODIFIER	silent_mutation	Average:56.758; most accessible tissue: Zhenshan97 root, score: 81.351	N	N	N	N
vg1124652420	A -> C	LOC_Os11g41160.3	downstream_gene_variant ; 3385.0bp to feature; MODIFIER	silent_mutation	Average:56.758; most accessible tissue: Zhenshan97 root, score: 81.351	N	N	N	N
vg1124652420	A -> C	LOC_Os11g41150.1	intron_variant ; MODIFIER	silent_mutation	Average:56.758; most accessible tissue: Zhenshan97 root, score: 81.351	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1124652420	NA	4.22E-06	mr1044	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124652420	NA	2.93E-06	mr1482	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124652420	NA	4.08E-07	mr1296_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124652420	NA	1.69E-07	mr1321_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124652420	NA	1.89E-07	mr1332_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124652420	NA	5.53E-07	mr1358_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124652420	4.68E-06	NA	mr1579_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124652420	NA	8.33E-09	mr1748_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124652420	1.52E-07	NA	mr1768_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124652420	2.70E-06	NA	mr1805_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251