| Variant ID: vg1124652420 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 24652420 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CGAGCCGCCGCCCGGAGCAGCGTGCACCTTGGTTGACGGCCGATCCTGCATAGTCTCACCACAATCAGTGTTCAACAACATCAGCATCCAGAAATTGTAC[A/C]
TTCATATATCAGAATCACAATCTTTATTTCACTCGAAAGATTGGAGAAAATTGGTTCAGAAAAAAAAATCATGCCTAGAACATCAGCAAGTTCCATTTGC
GCAAATGGAACTTGCTGATGTTCTAGGCATGATTTTTTTTTCTGAACCAATTTTCTCCAATCTTTCGAGTGAAATAAAGATTGTGATTCTGATATATGAA[T/G]
GTACAATTTCTGGATGCTGATGTTGTTGAACACTGATTGTGGTGAGACTATGCAGGATCGGCCGTCAACCAAGGTGCACGCTGCTCCGGGCGGCGGCTCG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.50% | 7.50% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 79.40% | 20.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 81.50% | 18.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 73.40% | 26.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 85.10% | 14.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 82.30% | 17.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 84.40% | 15.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1124652420 | A -> C | LOC_Os11g41140.1 | downstream_gene_variant ; 623.0bp to feature; MODIFIER | silent_mutation | Average:56.758; most accessible tissue: Zhenshan97 root, score: 81.351 | N | N | N | N |
| vg1124652420 | A -> C | LOC_Os11g41160.1 | downstream_gene_variant ; 3385.0bp to feature; MODIFIER | silent_mutation | Average:56.758; most accessible tissue: Zhenshan97 root, score: 81.351 | N | N | N | N |
| vg1124652420 | A -> C | LOC_Os11g41160.2 | downstream_gene_variant ; 3385.0bp to feature; MODIFIER | silent_mutation | Average:56.758; most accessible tissue: Zhenshan97 root, score: 81.351 | N | N | N | N |
| vg1124652420 | A -> C | LOC_Os11g41160.3 | downstream_gene_variant ; 3385.0bp to feature; MODIFIER | silent_mutation | Average:56.758; most accessible tissue: Zhenshan97 root, score: 81.351 | N | N | N | N |
| vg1124652420 | A -> C | LOC_Os11g41150.1 | intron_variant ; MODIFIER | silent_mutation | Average:56.758; most accessible tissue: Zhenshan97 root, score: 81.351 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1124652420 | NA | 4.22E-06 | mr1044 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124652420 | NA | 2.93E-06 | mr1482 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124652420 | NA | 4.08E-07 | mr1296_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124652420 | NA | 1.69E-07 | mr1321_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124652420 | NA | 1.89E-07 | mr1332_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124652420 | NA | 5.53E-07 | mr1358_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124652420 | 4.68E-06 | NA | mr1579_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124652420 | NA | 8.33E-09 | mr1748_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124652420 | 1.52E-07 | NA | mr1768_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124652420 | 2.70E-06 | NA | mr1805_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |