Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1124647866:

Variant ID: vg1124647866 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 24647866
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAACGAATTAATTATGCTCAAAAAATTCGTCTCGCGGTTTCTAGGTGAGTTATGAAATTAGTTTTTTATTCGTGTCAAAACCTCTTCTGAATGAACATTT[A/G]
GTTAAACGTCCGATGTGACACTCAATAATTTTCTTTTCACGAACTAAACCAGGCCTTAGCAAGCAGCAGCTAACGGGTCCCACCCGCTTGGGAAGCGGAT

Reverse complement sequence

ATCCGCTTCCCAAGCGGGTGGGACCCGTTAGCTGCTGCTTGCTAAGGCCTGGTTTAGTTCGTGAAAAGAAAATTATTGAGTGTCACATCGGACGTTTAAC[T/C]
AAATGTTCATTCAGAAGAGGTTTTGACACGAATAAAAAACTAATTTCATAACTCACCTAGAAACCGCGAGACGAATTTTTTGAGCATAATTAATTCGTTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.60%	23.00%	0.38%	4.02%	NA
All Indica	2759	96.70%	3.00%	0.00%	0.25%	NA
All Japonica	1512	32.10%	55.00%	1.06%	11.84%	NA
Aus	269	61.70%	37.90%	0.37%	0.00%	NA
Indica I	595	99.50%	0.50%	0.00%	0.00%	NA
Indica II	465	97.80%	1.70%	0.00%	0.43%	NA
Indica III	913	94.60%	5.10%	0.00%	0.22%	NA
Indica Intermediate	786	96.30%	3.30%	0.00%	0.38%	NA
Temperate Japonica	767	24.80%	70.50%	0.26%	4.43%	NA
Tropical Japonica	504	37.90%	35.30%	2.18%	24.60%	NA
Japonica Intermediate	241	43.20%	46.90%	1.24%	8.71%	NA
VI/Aromatic	96	47.90%	52.10%	0.00%	0.00%	NA
Intermediate	90	71.10%	23.30%	1.11%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1124647866	A -> DEL	N	N	silent_mutation	Average:96.475; most accessible tissue: Zhenshan97 root, score: 98.69	N	N	N	N
vg1124647866	A -> G	LOC_Os11g41140.1	upstream_gene_variant ; 181.0bp to feature; MODIFIER	silent_mutation	Average:96.475; most accessible tissue: Zhenshan97 root, score: 98.69	N	N	N	N
vg1124647866	A -> G	LOC_Os11g41130.2	downstream_gene_variant ; 875.0bp to feature; MODIFIER	silent_mutation	Average:96.475; most accessible tissue: Zhenshan97 root, score: 98.69	N	N	N	N
vg1124647866	A -> G	LOC_Os11g41150.1	downstream_gene_variant ; 4077.0bp to feature; MODIFIER	silent_mutation	Average:96.475; most accessible tissue: Zhenshan97 root, score: 98.69	N	N	N	N
vg1124647866	A -> G	LOC_Os11g41130-LOC_Os11g41140	intergenic_region ; MODIFIER	silent_mutation	Average:96.475; most accessible tissue: Zhenshan97 root, score: 98.69	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1124647866	A	G	-0.01	0.01	0.02	0.02	0.01	0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1124647866	NA	7.21E-11	mr1790	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124647866	NA	5.77E-06	mr1790	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124647866	NA	3.35E-06	mr1871	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124647866	NA	4.69E-07	mr1248_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124647866	NA	3.40E-08	mr1746_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124647866	9.57E-08	NA	mr1758_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251