\
| Variant ID: vg1124633481 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 24633481 |
| Reference Allele: G | Alternative Allele: T,C |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
AAGTTTTTGGGAACTAAACAGGGCCAAAAACTTTTGGAATCCCATTATGCAGCCTAGCTACTTGGATGTCCAAAAATTTCAAAGTGGCATTACTAGAGAA[G/T,C]
GATCCTCTCTATACAAATCAATATAACCCGTAAATTAATTGTACCTTTATTATGTTCAGGGACATGACAATGAAAACAATAAGTCAAATGTTGATGACCT
AGGTCATCAACATTTGACTTATTGTTTTCATTGTCATGTCCCTGAACATAATAAAGGTACAATTAATTTACGGGTTATATTGATTTGTATAGAGAGGATC[C/A,G]
TTCTCTAGTAATGCCACTTTGAAATTTTTGGACATCCAAGTAGCTAGGCTGCATAATGGGATTCCAAAAGTTTTTGGCCCTGTTTAGTTCCCAAAAACTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.40% | 38.50% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 94.60% | 5.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 6.30% | 93.70% | 0.07% | 0.00% | NA |
| Aus | 269 | 40.90% | 59.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 92.90% | 7.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 91.90% | 8.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 3.80% | 96.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 7.70% | 92.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 11.20% | 88.40% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 45.80% | 54.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 50.00% | 50.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1124633481 | G -> T | LOC_Os11g41110.1 | downstream_gene_variant ; 1837.0bp to feature; MODIFIER | silent_mutation | Average:50.583; most accessible tissue: Callus, score: 84.486 | N | N | N | N |
| vg1124633481 | G -> T | LOC_Os11g41110-LOC_Os11g41130 | intergenic_region ; MODIFIER | silent_mutation | Average:50.583; most accessible tissue: Callus, score: 84.486 | N | N | N | N |
| vg1124633481 | G -> C | LOC_Os11g41110.1 | downstream_gene_variant ; 1837.0bp to feature; MODIFIER | N | Average:50.583; most accessible tissue: Callus, score: 84.486 | N | N | N | N |
| vg1124633481 | G -> C | LOC_Os11g41110-LOC_Os11g41130 | intergenic_region ; MODIFIER | N | Average:50.583; most accessible tissue: Callus, score: 84.486 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1124633481 | NA | 3.77E-12 | mr1034 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124633481 | NA | 3.75E-11 | mr1316 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124633481 | NA | 1.21E-26 | mr1537 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124633481 | NA | 6.23E-20 | mr1541 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124633481 | NA | 5.78E-18 | mr1566 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124633481 | NA | 1.18E-09 | mr1578 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124633481 | NA | 5.94E-11 | mr1609 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124633481 | NA | 6.92E-61 | mr1671 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124633481 | NA | 2.50E-18 | mr1700 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124633481 | 4.27E-06 | NA | mr1758 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124633481 | NA | 1.96E-12 | mr1819 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124633481 | NA | 3.10E-07 | mr1836 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124633481 | NA | 3.15E-23 | mr1841 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124633481 | NA | 2.73E-15 | mr1916 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124633481 | NA | 1.07E-09 | mr1945 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124633481 | NA | 2.26E-16 | mr1836_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |