\
| Variant ID: vg1124617651 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 24617651 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TAGCATACCTTCCGAGATAGAAAAACTCAGTAGCCTCAGTGTCCTTCAAATGGATAGAAATTTTCTTTCTGGCCAAATTCCTGACACACTAGTAAATCTT[C/A]
AAAACTTGTCAATCCTAAGTTTGTCCAACAACAAGCTTTCTGGAGAGATCCCACGATCAATTGGAAAATTAGAGCAGCTTACTAAACTTTATCTTCAGGA
TCCTGAAGATAAAGTTTAGTAAGCTGCTCTAATTTTCCAATTGATCGTGGGATCTCTCCAGAAAGCTTGTTGTTGGACAAACTTAGGATTGACAAGTTTT[G/T]
AAGATTTACTAGTGTGTCAGGAATTTGGCCAGAAAGAAAATTTCTATCCATTTGAAGGACACTGAGGCTACTGAGTTTTTCTATCTCGGAAGGTATGCTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 45.90% | 15.90% | 1.21% | 37.01% | NA |
| All Indica | 2759 | 46.60% | 2.50% | 0.98% | 49.91% | NA |
| All Japonica | 1512 | 52.10% | 33.10% | 1.39% | 13.43% | NA |
| Aus | 269 | 15.20% | 55.80% | 2.23% | 26.77% | NA |
| Indica I | 595 | 58.70% | 3.70% | 0.67% | 36.97% | NA |
| Indica II | 465 | 17.40% | 0.90% | 0.43% | 81.29% | NA |
| Indica III | 913 | 53.80% | 2.00% | 0.88% | 43.37% | NA |
| Indica Intermediate | 786 | 46.60% | 3.10% | 1.65% | 48.73% | NA |
| Temperate Japonica | 767 | 59.50% | 29.20% | 1.56% | 9.78% | NA |
| Tropical Japonica | 504 | 48.40% | 31.30% | 0.99% | 19.25% | NA |
| Japonica Intermediate | 241 | 36.50% | 49.00% | 1.66% | 12.86% | NA |
| VI/Aromatic | 96 | 15.60% | 17.70% | 0.00% | 66.67% | NA |
| Intermediate | 90 | 42.20% | 17.80% | 3.33% | 36.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1124617651 | C -> A | LOC_Os11g41100.1 | missense_variant ; p.Gln513Lys; MODERATE | nonsynonymous_codon ; Q513K | Average:19.126; most accessible tissue: Zhenshan97 flower, score: 45.926 | benign |
0.048 |
TOLERATED | 0.76 |
| vg1124617651 | C -> DEL | LOC_Os11g41100.1 | N | frameshift_variant | Average:19.126; most accessible tissue: Zhenshan97 flower, score: 45.926 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1124617651 | NA | 6.88E-10 | mr1465 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124617651 | NA | 9.64E-08 | mr1666 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124617651 | NA | 3.89E-07 | mr1041_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124617651 | NA | 2.42E-06 | mr1263_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124617651 | NA | 2.12E-06 | mr1294_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124617651 | NA | 7.21E-08 | mr1302_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124617651 | NA | 1.23E-06 | mr1488_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124617651 | NA | 1.14E-08 | mr1604_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124617651 | NA | 4.91E-07 | mr1729_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124617651 | NA | 4.47E-09 | mr1751_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124617651 | 9.84E-06 | 9.75E-08 | mr1813_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124617651 | NA | 1.12E-07 | mr1824_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124617651 | 2.60E-06 | 4.65E-06 | mr1854_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124617651 | NA | 2.22E-07 | mr1894_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |