\
| Variant ID: vg1124587485 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 24587485 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TCACACGAGCTCCGCTCATCCTCATCGCATCACCGAGGCAAGAGCAAGAGGAGCCCTTAACCTGGATCACCGACTGCTCCAAAGCCTTCCAGGTGCGATC[G/A]
ATCAAGGCGGCAATGGATGCTCGCCAACCACCTCCTTTTTACGATGGGGATTGGGGGGGGCAGCCTTCGCTGGAGCTCACCAGTCAGCCTCCTCGCAGCG
CGCTGCGAGGAGGCTGACTGGTGAGCTCCAGCGAAGGCTGCCCCCCCCAATCCCCATCGTAAAAAGGAGGTGGTTGGCGAGCATCCATTGCCGCCTTGAT[C/T]
GATCGCACCTGGAAGGCTTTGGAGCAGTCGGTGATCCAGGTTAAGGGCTCCTCTTGCTCTTGCCTCGGTGATGCGATGAGGATGAGCGGAGCTCGTGTGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.60% | 25.90% | 0.87% | 9.65% | NA |
| All Indica | 2759 | 73.10% | 13.50% | 0.36% | 13.05% | NA |
| All Japonica | 1512 | 40.80% | 52.10% | 1.92% | 5.22% | NA |
| Aus | 269 | 86.60% | 13.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 76.30% | 3.70% | 0.17% | 19.83% | NA |
| Indica II | 465 | 72.30% | 25.20% | 0.22% | 2.37% | NA |
| Indica III | 913 | 75.10% | 12.50% | 0.44% | 11.94% | NA |
| Indica Intermediate | 786 | 68.80% | 15.10% | 0.51% | 15.52% | NA |
| Temperate Japonica | 767 | 67.30% | 31.30% | 0.39% | 1.04% | NA |
| Tropical Japonica | 504 | 8.50% | 76.80% | 3.97% | 10.71% | NA |
| Japonica Intermediate | 241 | 24.10% | 66.40% | 2.49% | 7.05% | NA |
| VI/Aromatic | 96 | 85.40% | 4.20% | 0.00% | 10.42% | NA |
| Intermediate | 90 | 62.20% | 27.80% | 2.22% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1124587485 | G -> A | LOC_Os11g41050.1 | downstream_gene_variant ; 1500.0bp to feature; MODIFIER | silent_mutation | Average:34.857; most accessible tissue: Callus, score: 61.926 | N | N | N | N |
| vg1124587485 | G -> A | LOC_Os11g41050-LOC_Os11g41060 | intergenic_region ; MODIFIER | silent_mutation | Average:34.857; most accessible tissue: Callus, score: 61.926 | N | N | N | N |
| vg1124587485 | G -> DEL | N | N | silent_mutation | Average:34.857; most accessible tissue: Callus, score: 61.926 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1124587485 | NA | 5.47E-09 | mr1585 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124587485 | NA | 3.36E-11 | mr1609 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124587485 | 3.79E-06 | 5.87E-07 | mr1766 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124587485 | NA | 8.96E-13 | mr1900 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124587485 | NA | 9.49E-06 | mr1900 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124587485 | 5.27E-06 | NA | mr1609_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124587485 | NA | 4.62E-08 | mr1609_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124587485 | NA | 1.79E-09 | mr1696_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124587485 | 1.54E-06 | NA | mr1900_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |