\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124474541:

Variant ID: vg1124474541 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 24474541
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 55. )

Flanking Sequence (100 bp) in Reference Genome:


CACCCTTGCCCTCTACTATACTACAATAGAGTTCACTGGCTGATTAATGAGCAGCCTCAACATCCAAAAATGCATCTTAAGCTGGAGTCGTCGGTCGCTG[C/T]
AAGATTTCTGATGCTGGCAAGATGAATGAGGATCAAAGGTGAGGATAGTAAAACTACTCAACAGATAGTATCCGACCAAGTTGATGATGGAAGAGCACGC

Reverse complement sequence

GCGTGCTCTTCCATCATCAACTTGGTCGGATACTATCTGTTGAGTAGTTTTACTATCCTCACCTTTGATCCTCATTCATCTTGCCAGCATCAGAAATCTT[G/A]
CAGCGACCGACGACTCCAGCTTAAGATGCATTTTTGGATGTTGAGGCTGCTCATTAATCAGCCAGTGAACTCTATTGTAGTATAGTAGAGGGCAAGGGTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.60% 29.20% 2.52% 19.70% NA
All Indica  2759 30.80% 36.90% 3.95% 28.38% NA
All Japonica  1512 88.20% 4.40% 0.26% 7.08% NA
Aus  269 16.40% 69.50% 0.74% 13.38% NA
Indica I  595 25.00% 36.80% 5.55% 32.61% NA
Indica II  465 30.50% 53.50% 4.30% 11.61% NA
Indica III  913 28.80% 30.20% 2.74% 38.23% NA
Indica Intermediate  786 37.50% 34.90% 3.94% 23.66% NA
Temperate Japonica  767 94.50% 3.50% 0.00% 1.96% NA
Tropical Japonica  504 79.60% 6.20% 0.40% 13.89% NA
Japonica Intermediate  241 86.30% 3.70% 0.83% 9.13% NA
VI/Aromatic  96 27.10% 71.90% 0.00% 1.04% NA
Intermediate  90 48.90% 42.20% 4.44% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1124474541 C -> T LOC_Os11g40890.1 downstream_gene_variant ; 2038.0bp to feature; MODIFIER silent_mutation Average:45.735; most accessible tissue: Zhenshan97 young leaf, score: 78.938 N N N N
vg1124474541 C -> T LOC_Os11g40870-LOC_Os11g40890 intergenic_region ; MODIFIER silent_mutation Average:45.735; most accessible tissue: Zhenshan97 young leaf, score: 78.938 N N N N
vg1124474541 C -> DEL N N silent_mutation Average:45.735; most accessible tissue: Zhenshan97 young leaf, score: 78.938 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1124474541 NA 9.43E-06 mr1377 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124474541 NA 1.61E-07 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124474541 7.39E-06 NA mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124474541 8.66E-09 8.66E-09 mr1855 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124474541 NA 3.72E-06 mr1962 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124474541 3.72E-06 6.58E-07 mr1332_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124474541 6.58E-06 1.41E-09 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124474541 1.50E-06 6.00E-06 mr1662_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124474541 9.34E-07 9.34E-07 mr1822_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251