\
| Variant ID: vg1124474541 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 24474541 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 55. )
CACCCTTGCCCTCTACTATACTACAATAGAGTTCACTGGCTGATTAATGAGCAGCCTCAACATCCAAAAATGCATCTTAAGCTGGAGTCGTCGGTCGCTG[C/T]
AAGATTTCTGATGCTGGCAAGATGAATGAGGATCAAAGGTGAGGATAGTAAAACTACTCAACAGATAGTATCCGACCAAGTTGATGATGGAAGAGCACGC
GCGTGCTCTTCCATCATCAACTTGGTCGGATACTATCTGTTGAGTAGTTTTACTATCCTCACCTTTGATCCTCATTCATCTTGCCAGCATCAGAAATCTT[G/A]
CAGCGACCGACGACTCCAGCTTAAGATGCATTTTTGGATGTTGAGGCTGCTCATTAATCAGCCAGTGAACTCTATTGTAGTATAGTAGAGGGCAAGGGTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 48.60% | 29.20% | 2.52% | 19.70% | NA |
| All Indica | 2759 | 30.80% | 36.90% | 3.95% | 28.38% | NA |
| All Japonica | 1512 | 88.20% | 4.40% | 0.26% | 7.08% | NA |
| Aus | 269 | 16.40% | 69.50% | 0.74% | 13.38% | NA |
| Indica I | 595 | 25.00% | 36.80% | 5.55% | 32.61% | NA |
| Indica II | 465 | 30.50% | 53.50% | 4.30% | 11.61% | NA |
| Indica III | 913 | 28.80% | 30.20% | 2.74% | 38.23% | NA |
| Indica Intermediate | 786 | 37.50% | 34.90% | 3.94% | 23.66% | NA |
| Temperate Japonica | 767 | 94.50% | 3.50% | 0.00% | 1.96% | NA |
| Tropical Japonica | 504 | 79.60% | 6.20% | 0.40% | 13.89% | NA |
| Japonica Intermediate | 241 | 86.30% | 3.70% | 0.83% | 9.13% | NA |
| VI/Aromatic | 96 | 27.10% | 71.90% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 48.90% | 42.20% | 4.44% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1124474541 | C -> T | LOC_Os11g40890.1 | downstream_gene_variant ; 2038.0bp to feature; MODIFIER | silent_mutation | Average:45.735; most accessible tissue: Zhenshan97 young leaf, score: 78.938 | N | N | N | N |
| vg1124474541 | C -> T | LOC_Os11g40870-LOC_Os11g40890 | intergenic_region ; MODIFIER | silent_mutation | Average:45.735; most accessible tissue: Zhenshan97 young leaf, score: 78.938 | N | N | N | N |
| vg1124474541 | C -> DEL | N | N | silent_mutation | Average:45.735; most accessible tissue: Zhenshan97 young leaf, score: 78.938 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1124474541 | NA | 9.43E-06 | mr1377 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124474541 | NA | 1.61E-07 | mr1662 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124474541 | 7.39E-06 | NA | mr1662 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124474541 | 8.66E-09 | 8.66E-09 | mr1855 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124474541 | NA | 3.72E-06 | mr1962 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124474541 | 3.72E-06 | 6.58E-07 | mr1332_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124474541 | 6.58E-06 | 1.41E-09 | mr1662_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124474541 | 1.50E-06 | 6.00E-06 | mr1662_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124474541 | 9.34E-07 | 9.34E-07 | mr1822_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |