Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124474270:

Variant ID: vg1124474270 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 24474270
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, A: 0.09, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

TGCTCCAGATTGTTCCAACAACCACTTAATAAAATTTTGACAGGAGAATACATAAGTGATTAATTAGTCGTTAACTTTATCCTTGTTTTTGGACAAAGGG[G/A]
CATGATCACTAGCTAGCATAACCACGTGCTAATCTTTGTGAAATGGCCAATTTTGCTTACTGACACAGCCACATGTACAAAGGCCTTCAGCTTTCCTTTA

Reverse complement sequence

TAAAGGAAAGCTGAAGGCCTTTGTACATGTGGCTGTGTCAGTAAGCAAAATTGGCCATTTCACAAAGATTAGCACGTGGTTATGCTAGCTAGTGATCATG[C/T]
CCCTTTGTCCAAAAACAAGGATAAAGTTAACGACTAATTAATCACTTATGTATTCTCCTGTCAAAATTTTATTAAGTGGTTGTTGGAACAATCTGGAGCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	48.60%	10.70%	6.05%	34.66%	NA
All Indica	2759	30.60%	16.50%	6.92%	45.99%	NA
All Japonica	1512	88.20%	1.10%	1.06%	9.59%	NA
Aus	269	17.50%	7.10%	17.84%	57.62%	NA
Indica I	595	25.20%	18.50%	8.24%	48.07%	NA
Indica II	465	30.50%	22.80%	8.39%	38.28%	NA
Indica III	913	28.40%	12.90%	5.04%	53.67%	NA
Indica Intermediate	786	37.40%	15.30%	7.25%	40.08%	NA
Temperate Japonica	767	94.40%	0.50%	1.17%	3.91%	NA
Tropical Japonica	504	79.80%	1.80%	1.19%	17.26%	NA
Japonica Intermediate	241	86.30%	1.70%	0.41%	11.62%	NA
VI/Aromatic	96	28.10%	7.30%	19.79%	44.79%	NA
Intermediate	90	48.90%	8.90%	13.33%	28.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1124474270	G -> A	LOC_Os11g40890.1	downstream_gene_variant ; 2309.0bp to feature; MODIFIER	silent_mutation	Average:45.705; most accessible tissue: Zhenshan97 young leaf, score: 72.747	N	N	N	N
vg1124474270	G -> A	LOC_Os11g40870-LOC_Os11g40890	intergenic_region ; MODIFIER	silent_mutation	Average:45.705; most accessible tissue: Zhenshan97 young leaf, score: 72.747	N	N	N	N
vg1124474270	G -> DEL	N	N	silent_mutation	Average:45.705; most accessible tissue: Zhenshan97 young leaf, score: 72.747	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1124474270	NA	1.50E-07	mr1662	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124474270	8.45E-09	8.44E-09	mr1855	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124474270	NA	4.23E-06	mr1962	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124474270	5.41E-06	1.01E-06	mr1332_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124474270	3.37E-06	NA	mr1509_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124474270	NA	2.41E-08	mr1662_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124474270	1.18E-06	1.18E-06	mr1822_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251