| Variant ID: vg1124474136 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 24474136 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.84, A: 0.16, others allele: 0.00, population size: 86. )
TTTTCTTTCTGGTCACATACAAGTTTGATAGGGAGGGATATATATATCTTGTAGGCAATTTTCTCAACTAAATGACTGAAAATAATGAGCTTGGTAGTTT[T/A]
TACAGATGCATGGAACTGATTCTATGCATTTATTGCTCCAGATTGTTCCAACAACCACTTAATAAAATTTTGACAGGAGAATACATAAGTGATTAATTAG
CTAATTAATCACTTATGTATTCTCCTGTCAAAATTTTATTAAGTGGTTGTTGGAACAATCTGGAGCAATAAATGCATAGAATCAGTTCCATGCATCTGTA[A/T]
AAACTACCAAGCTCATTATTTTCAGTCATTTAGTTGAGAAAATTGCCTACAAGATATATATATCCCTCCCTATCAAACTTGTATGTGACCAGAAAGAAAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.00% | 33.10% | 0.97% | 27.85% | NA |
| All Indica | 2759 | 29.90% | 42.90% | 0.54% | 26.68% | NA |
| All Japonica | 1512 | 59.80% | 5.10% | 1.52% | 33.60% | NA |
| Aus | 269 | 4.10% | 72.50% | 1.12% | 22.30% | NA |
| Indica I | 595 | 25.00% | 41.20% | 1.01% | 32.77% | NA |
| Indica II | 465 | 30.30% | 64.30% | 0.43% | 4.95% | NA |
| Indica III | 913 | 27.30% | 34.90% | 0.33% | 37.46% | NA |
| Indica Intermediate | 786 | 36.40% | 40.70% | 0.51% | 22.39% | NA |
| Temperate Japonica | 767 | 71.70% | 4.30% | 1.04% | 22.95% | NA |
| Tropical Japonica | 504 | 50.00% | 6.50% | 1.19% | 42.26% | NA |
| Japonica Intermediate | 241 | 42.30% | 4.60% | 3.73% | 49.38% | NA |
| VI/Aromatic | 96 | 24.00% | 70.80% | 4.17% | 1.04% | NA |
| Intermediate | 90 | 38.90% | 47.80% | 1.11% | 12.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1124474136 | T -> A | LOC_Os11g40890.1 | downstream_gene_variant ; 2443.0bp to feature; MODIFIER | silent_mutation | Average:37.859; most accessible tissue: Zhenshan97 flower, score: 68.734 | N | N | N | N |
| vg1124474136 | T -> A | LOC_Os11g40870-LOC_Os11g40890 | intergenic_region ; MODIFIER | silent_mutation | Average:37.859; most accessible tissue: Zhenshan97 flower, score: 68.734 | N | N | N | N |
| vg1124474136 | T -> DEL | N | N | silent_mutation | Average:37.859; most accessible tissue: Zhenshan97 flower, score: 68.734 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1124474136 | NA | 8.83E-08 | mr1662 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124474136 | 8.30E-09 | 8.30E-09 | mr1855 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124474136 | NA | 3.91E-06 | mr1962 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124474136 | 5.57E-06 | 1.01E-06 | mr1332_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124474136 | 2.32E-06 | 5.87E-16 | mr1416_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124474136 | 3.94E-06 | NA | mr1509_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124474136 | NA | 1.27E-07 | mr1662_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124474136 | NA | 2.09E-09 | mr1705_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124474136 | 1.15E-06 | 1.15E-06 | mr1822_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |