\
| Variant ID: vg1124469615 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 24469615 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 63. )
CCTCCCCCTCCGCGGTAGCACGGGCCAGCTCCCGCCGCCGGTTGCCGCCTTGCCTCGTCGCGCCGCCGCCTAGGGTTTGCAAATAGGGAGCGGCGCGAGG[G/A]
AGCCGAGCTATGGAGGGATGGGTCACGGAGGGAGAGCGAGAGGGCGCCGTCTGGTAGAGTGGTGGCTAAGTGGGTCAACTGATGTCTGATGGGTCACGAC
GTCGTGACCCATCAGACATCAGTTGACCCACTTAGCCACCACTCTACCAGACGGCGCCCTCTCGCTCTCCCTCCGTGACCCATCCCTCCATAGCTCGGCT[C/T]
CCTCGCGCCGCTCCCTATTTGCAAACCCTAGGCGGCGGCGCGACGAGGCAAGGCGGCAACCGGCGGCGGGAGCTGGCCCGTGCTACCGCGGAGGGGGAGG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 27.50% | 22.70% | 1.29% | 48.58% | NA |
| All Indica | 2759 | 38.60% | 7.10% | 1.12% | 53.14% | NA |
| All Japonica | 1512 | 4.40% | 46.20% | 1.06% | 48.35% | NA |
| Aus | 269 | 42.00% | 30.90% | 2.60% | 24.54% | NA |
| Indica I | 595 | 40.30% | 3.70% | 0.17% | 55.80% | NA |
| Indica II | 465 | 54.20% | 13.80% | 1.08% | 30.97% | NA |
| Indica III | 913 | 33.30% | 4.80% | 1.31% | 60.57% | NA |
| Indica Intermediate | 786 | 34.40% | 8.40% | 1.65% | 55.60% | NA |
| Temperate Japonica | 767 | 3.70% | 47.10% | 1.04% | 48.24% | NA |
| Tropical Japonica | 504 | 5.20% | 50.20% | 0.40% | 44.25% | NA |
| Japonica Intermediate | 241 | 5.00% | 35.30% | 2.49% | 57.26% | NA |
| VI/Aromatic | 96 | 18.80% | 67.70% | 4.17% | 9.38% | NA |
| Intermediate | 90 | 38.90% | 31.10% | 3.33% | 26.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1124469615 | G -> A | LOC_Os11g40870-LOC_Os11g40890 | intergenic_region ; MODIFIER | silent_mutation | Average:9.179; most accessible tissue: Callus, score: 27.678 | N | N | N | N |
| vg1124469615 | G -> DEL | N | N | silent_mutation | Average:9.179; most accessible tissue: Callus, score: 27.678 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1124469615 | 2.15E-11 | 8.04E-14 | mr1238 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124469615 | 3.61E-06 | NA | mr1309 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124469615 | 1.62E-11 | 3.46E-14 | mr1309 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124469615 | 6.04E-07 | 3.00E-08 | mr1484 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124469615 | 7.44E-06 | NA | mr1841 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124469615 | 2.52E-08 | 2.74E-10 | mr1841 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124469615 | 9.43E-07 | 9.43E-07 | mr1900 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124469615 | 2.85E-06 | NA | mr1238_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124469615 | 4.85E-09 | 9.70E-13 | mr1238_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124469615 | NA | 7.07E-06 | mr1379_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124469615 | NA | 4.31E-06 | mr1409_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124469615 | 2.10E-06 | NA | mr1484_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124469615 | 5.21E-10 | 2.64E-13 | mr1484_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124469615 | 4.24E-06 | NA | mr1609_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124469615 | 3.16E-06 | 3.12E-08 | mr1609_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124469615 | 7.61E-12 | 9.82E-17 | mr1841_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124469615 | 6.91E-09 | 2.59E-12 | mr1900_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124469615 | 2.41E-06 | NA | mr1945_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124469615 | 1.91E-08 | 1.91E-08 | mr1945_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |