\
| Variant ID: vg1124468452 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 24468452 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.07, others allele: 0.00, population size: 69. )
TCCATCAAATTTCGCATGAATGGATTTGTCTGAAGATTCTAGTCAGACAAGCATGGAGTCACAGTGCTCTCAAATACAGCACGATCTTTCTGTTTATGTT[G/A]
CATGTTCTCTCTATAGTCTCCCGTTGTTAAGTAATTAACGGAAGCGAGAAAAGTAATTAAGGGAAGCCATAGTCAACTACAGGTCTGAGGGCAGATGTAC
GTACATCTGCCCTCAGACCTGTAGTTGACTATGGCTTCCCTTAATTACTTTTCTCGCTTCCGTTAATTACTTAACAACGGGAGACTATAGAGAGAACATG[C/T]
AACATAAACAGAAAGATCGTGCTGTATTTGAGAGCACTGTGACTCCATGCTTGTCTGACTAGAATCTTCAGACAAATCCATTCATGCGAAATTTGATGGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 34.40% | 10.60% | 0.83% | 54.15% | NA |
| All Indica | 2759 | 30.70% | 4.80% | 0.80% | 63.68% | NA |
| All Japonica | 1512 | 46.80% | 7.70% | 0.53% | 45.04% | NA |
| Aus | 269 | 5.60% | 67.70% | 0.37% | 26.39% | NA |
| Indica I | 595 | 29.20% | 0.20% | 0.17% | 70.42% | NA |
| Indica II | 465 | 31.60% | 10.50% | 0.43% | 57.42% | NA |
| Indica III | 913 | 26.50% | 1.80% | 1.53% | 70.21% | NA |
| Indica Intermediate | 786 | 36.30% | 8.40% | 0.64% | 54.71% | NA |
| Temperate Japonica | 767 | 48.10% | 1.20% | 0.39% | 50.33% | NA |
| Tropical Japonica | 504 | 49.20% | 15.70% | 0.60% | 34.52% | NA |
| Japonica Intermediate | 241 | 37.30% | 11.60% | 0.83% | 50.21% | NA |
| VI/Aromatic | 96 | 15.60% | 63.50% | 7.29% | 13.54% | NA |
| Intermediate | 90 | 45.60% | 12.20% | 1.11% | 41.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1124468452 | G -> A | LOC_Os11g40870-LOC_Os11g40890 | intergenic_region ; MODIFIER | silent_mutation | Average:45.439; most accessible tissue: Callus, score: 60.219 | N | N | N | N |
| vg1124468452 | G -> DEL | N | N | silent_mutation | Average:45.439; most accessible tissue: Callus, score: 60.219 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1124468452 | 6.05E-17 | 7.24E-20 | mr1238 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124468452 | 3.18E-16 | 2.40E-19 | mr1309 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124468452 | 7.71E-08 | 1.43E-08 | mr1484 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124468452 | 3.23E-06 | 3.23E-06 | mr1566 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124468452 | 2.73E-11 | 9.32E-14 | mr1841 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124468452 | 1.13E-11 | 1.13E-11 | mr1900 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124468452 | 9.10E-06 | 9.10E-06 | mr1945 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124468452 | 2.58E-15 | 1.32E-18 | mr1238_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124468452 | 1.89E-16 | 1.54E-19 | mr1484_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124468452 | 4.93E-07 | 1.97E-08 | mr1609_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124468452 | 1.41E-17 | 1.42E-22 | mr1841_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124468452 | 1.15E-11 | 3.83E-15 | mr1900_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124468452 | 4.08E-13 | 4.08E-13 | mr1945_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |