\
| Variant ID: vg1124453926 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 24453926 |
| Reference Allele: C | Alternative Allele: T,A |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.67, T: 0.34, others allele: 0.00, population size: 82. )
GTCATGTGGTCTCTTAGGAGGCCCACCTAAAAAAATAAACTTATTTTTGTAGGCGGATCTATTAAGGGGCCACATGAGAAAATGTATTTTTCTTACGACC[C/T,A]
GTGAAACTTCCTTCGAATATAATTTTTGCAGGCACGACCTGTTACAACCTGCCTATAACCTTCGTATAGAAAAATCGTTTCTGTAGTAGTGTATACTGCG
CGCAGTATACACTACTACAGAAACGATTTTTCTATACGAAGGTTATAGGCAGGTTGTAACAGGTCGTGCCTGCAAAAATTATATTCGAAGGAAGTTTCAC[G/A,T]
GGTCGTAAGAAAAATACATTTTCTCATGTGGCCCCTTAATAGATCCGCCTACAAAAATAAGTTTATTTTTTTAGGTGGGCCTCCTAAGAGACCACATGAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.50% | 13.10% | 0.08% | 0.00% | A: 2.29% |
| All Indica | 2759 | 95.40% | 4.50% | 0.00% | 0.00% | A: 0.07% |
| All Japonica | 1512 | 69.70% | 23.30% | 0.00% | 0.00% | A: 6.94% |
| Aus | 269 | 73.20% | 26.00% | 0.37% | 0.00% | A: 0.37% |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 88.20% | 11.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 93.40% | 6.40% | 0.00% | 0.00% | A: 0.25% |
| Temperate Japonica | 767 | 90.50% | 8.30% | 0.00% | 0.00% | A: 1.17% |
| Tropical Japonica | 504 | 38.10% | 47.20% | 0.00% | 0.00% | A: 14.68% |
| Japonica Intermediate | 241 | 69.70% | 21.20% | 0.00% | 0.00% | A: 9.13% |
| VI/Aromatic | 96 | 40.60% | 57.30% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 17.80% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1124453926 | C -> T | LOC_Os11g40870.1 | downstream_gene_variant ; 1991.0bp to feature; MODIFIER | silent_mutation | Average:63.754; most accessible tissue: Zhenshan97 flag leaf, score: 82.529 | N | N | N | N |
| vg1124453926 | C -> T | LOC_Os11g40870-LOC_Os11g40890 | intergenic_region ; MODIFIER | silent_mutation | Average:63.754; most accessible tissue: Zhenshan97 flag leaf, score: 82.529 | N | N | N | N |
| vg1124453926 | C -> A | LOC_Os11g40870.1 | downstream_gene_variant ; 1991.0bp to feature; MODIFIER | silent_mutation | Average:63.754; most accessible tissue: Zhenshan97 flag leaf, score: 82.529 | N | N | N | N |
| vg1124453926 | C -> A | LOC_Os11g40870-LOC_Os11g40890 | intergenic_region ; MODIFIER | silent_mutation | Average:63.754; most accessible tissue: Zhenshan97 flag leaf, score: 82.529 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1124453926 | 5.57E-09 | NA | mr1238 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124453926 | 6.42E-08 | NA | mr1309 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124453926 | 9.93E-07 | NA | mr1484 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124453926 | 4.73E-08 | NA | mr1841 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124453926 | 5.93E-12 | NA | mr1238_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124453926 | 1.28E-12 | NA | mr1484_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124453926 | 2.21E-09 | NA | mr1609_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124453926 | 1.34E-12 | NA | mr1841_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124453926 | 5.92E-12 | NA | mr1900_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124453926 | 4.51E-06 | NA | mr1900_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124453926 | 4.97E-11 | NA | mr1945_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124453926 | NA | 6.39E-06 | mr1959_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |