\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124453926:

Variant ID: vg1124453926 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 24453926
Reference Allele: CAlternative Allele: T,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.67, T: 0.34, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


GTCATGTGGTCTCTTAGGAGGCCCACCTAAAAAAATAAACTTATTTTTGTAGGCGGATCTATTAAGGGGCCACATGAGAAAATGTATTTTTCTTACGACC[C/T,A]
GTGAAACTTCCTTCGAATATAATTTTTGCAGGCACGACCTGTTACAACCTGCCTATAACCTTCGTATAGAAAAATCGTTTCTGTAGTAGTGTATACTGCG

Reverse complement sequence

CGCAGTATACACTACTACAGAAACGATTTTTCTATACGAAGGTTATAGGCAGGTTGTAACAGGTCGTGCCTGCAAAAATTATATTCGAAGGAAGTTTCAC[G/A,T]
GGTCGTAAGAAAAATACATTTTCTCATGTGGCCCCTTAATAGATCCGCCTACAAAAATAAGTTTATTTTTTTAGGTGGGCCTCCTAAGAGACCACATGAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.50% 13.10% 0.08% 0.00% A: 2.29%
All Indica  2759 95.40% 4.50% 0.00% 0.00% A: 0.07%
All Japonica  1512 69.70% 23.30% 0.00% 0.00% A: 6.94%
Aus  269 73.20% 26.00% 0.37% 0.00% A: 0.37%
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 88.20% 11.80% 0.00% 0.00% NA
Indica III  913 97.80% 2.20% 0.00% 0.00% NA
Indica Intermediate  786 93.40% 6.40% 0.00% 0.00% A: 0.25%
Temperate Japonica  767 90.50% 8.30% 0.00% 0.00% A: 1.17%
Tropical Japonica  504 38.10% 47.20% 0.00% 0.00% A: 14.68%
Japonica Intermediate  241 69.70% 21.20% 0.00% 0.00% A: 9.13%
VI/Aromatic  96 40.60% 57.30% 2.08% 0.00% NA
Intermediate  90 81.10% 17.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1124453926 C -> T LOC_Os11g40870.1 downstream_gene_variant ; 1991.0bp to feature; MODIFIER silent_mutation Average:63.754; most accessible tissue: Zhenshan97 flag leaf, score: 82.529 N N N N
vg1124453926 C -> T LOC_Os11g40870-LOC_Os11g40890 intergenic_region ; MODIFIER silent_mutation Average:63.754; most accessible tissue: Zhenshan97 flag leaf, score: 82.529 N N N N
vg1124453926 C -> A LOC_Os11g40870.1 downstream_gene_variant ; 1991.0bp to feature; MODIFIER silent_mutation Average:63.754; most accessible tissue: Zhenshan97 flag leaf, score: 82.529 N N N N
vg1124453926 C -> A LOC_Os11g40870-LOC_Os11g40890 intergenic_region ; MODIFIER silent_mutation Average:63.754; most accessible tissue: Zhenshan97 flag leaf, score: 82.529 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1124453926 5.57E-09 NA mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124453926 6.42E-08 NA mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124453926 9.93E-07 NA mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124453926 4.73E-08 NA mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124453926 5.93E-12 NA mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124453926 1.28E-12 NA mr1484_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124453926 2.21E-09 NA mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124453926 1.34E-12 NA mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124453926 5.92E-12 NA mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124453926 4.51E-06 NA mr1900_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124453926 4.97E-11 NA mr1945_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124453926 NA 6.39E-06 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251