\
| Variant ID: vg1124448492 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 24448492 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, G: 0.01, others allele: 0.00, population size: 68. )
TTTATATATGTTCGGAGGGAGTAGTACAGTTAGAGTCTGTTTAGTTGTTGCCTAACATTGCCATAACTCAATTTGCTATAGATGTGGCATGGCAAACAAT[T/G]
TGTGGCCACAAGTGTGGCAATGTTTGGCTAGAAAATGAGTATACGACATGTAAGCCCATGAAACAAAAAAGTGTGGCTTGCCACAACTGAAACAAACAAC
GTTGTTTGTTTCAGTTGTGGCAAGCCACACTTTTTTGTTTCATGGGCTTACATGTCGTATACTCATTTTCTAGCCAAACATTGCCACACTTGTGGCCACA[A/C]
ATTGTTTGCCATGCCACATCTATAGCAAATTGAGTTATGGCAATGTTAGGCAACAACTAAACAGACTCTAACTGTACTACTCCCTCCGAACATATATAAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 36.80% | 13.00% | 9.10% | 41.09% | NA |
| All Indica | 2759 | 34.20% | 7.70% | 11.42% | 46.68% | NA |
| All Japonica | 1512 | 35.30% | 22.60% | 3.70% | 38.43% | NA |
| Aus | 269 | 59.90% | 17.80% | 8.92% | 13.38% | NA |
| Indica I | 595 | 25.00% | 11.90% | 19.33% | 43.70% | NA |
| Indica II | 465 | 46.20% | 5.60% | 6.24% | 41.94% | NA |
| Indica III | 913 | 26.50% | 6.50% | 8.11% | 58.93% | NA |
| Indica Intermediate | 786 | 42.90% | 7.30% | 12.34% | 37.53% | NA |
| Temperate Japonica | 767 | 31.40% | 37.80% | 4.17% | 26.60% | NA |
| Tropical Japonica | 504 | 31.50% | 5.00% | 3.37% | 60.12% | NA |
| Japonica Intermediate | 241 | 55.20% | 11.20% | 2.90% | 30.71% | NA |
| VI/Aromatic | 96 | 77.10% | 4.20% | 10.42% | 8.33% | NA |
| Intermediate | 90 | 33.30% | 6.70% | 27.78% | 32.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1124448492 | T -> DEL | N | N | silent_mutation | Average:41.52; most accessible tissue: Callus, score: 71.848 | N | N | N | N |
| vg1124448492 | T -> G | LOC_Os11g40870.1 | upstream_gene_variant ; 728.0bp to feature; MODIFIER | silent_mutation | Average:41.52; most accessible tissue: Callus, score: 71.848 | N | N | N | N |
| vg1124448492 | T -> G | LOC_Os11g40860.1 | downstream_gene_variant ; 2768.0bp to feature; MODIFIER | silent_mutation | Average:41.52; most accessible tissue: Callus, score: 71.848 | N | N | N | N |
| vg1124448492 | T -> G | LOC_Os11g40860-LOC_Os11g40870 | intergenic_region ; MODIFIER | silent_mutation | Average:41.52; most accessible tissue: Callus, score: 71.848 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1124448492 | 9.43E-06 | 1.97E-07 | mr1309 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124448492 | NA | 7.45E-06 | mr1165_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124448492 | NA | 3.32E-06 | mr1238_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124448492 | NA | 4.71E-06 | mr1268_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124448492 | NA | 7.23E-08 | mr1477_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124448492 | NA | 3.66E-09 | mr1609_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124448492 | NA | 1.88E-06 | mr1900_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124448492 | NA | 8.68E-06 | mr1925_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |