\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124448492:

Variant ID: vg1124448492 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 24448492
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, G: 0.01, others allele: 0.00, population size: 68. )

Flanking Sequence (100 bp) in Reference Genome:


TTTATATATGTTCGGAGGGAGTAGTACAGTTAGAGTCTGTTTAGTTGTTGCCTAACATTGCCATAACTCAATTTGCTATAGATGTGGCATGGCAAACAAT[T/G]
TGTGGCCACAAGTGTGGCAATGTTTGGCTAGAAAATGAGTATACGACATGTAAGCCCATGAAACAAAAAAGTGTGGCTTGCCACAACTGAAACAAACAAC

Reverse complement sequence

GTTGTTTGTTTCAGTTGTGGCAAGCCACACTTTTTTGTTTCATGGGCTTACATGTCGTATACTCATTTTCTAGCCAAACATTGCCACACTTGTGGCCACA[A/C]
ATTGTTTGCCATGCCACATCTATAGCAAATTGAGTTATGGCAATGTTAGGCAACAACTAAACAGACTCTAACTGTACTACTCCCTCCGAACATATATAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.80% 13.00% 9.10% 41.09% NA
All Indica  2759 34.20% 7.70% 11.42% 46.68% NA
All Japonica  1512 35.30% 22.60% 3.70% 38.43% NA
Aus  269 59.90% 17.80% 8.92% 13.38% NA
Indica I  595 25.00% 11.90% 19.33% 43.70% NA
Indica II  465 46.20% 5.60% 6.24% 41.94% NA
Indica III  913 26.50% 6.50% 8.11% 58.93% NA
Indica Intermediate  786 42.90% 7.30% 12.34% 37.53% NA
Temperate Japonica  767 31.40% 37.80% 4.17% 26.60% NA
Tropical Japonica  504 31.50% 5.00% 3.37% 60.12% NA
Japonica Intermediate  241 55.20% 11.20% 2.90% 30.71% NA
VI/Aromatic  96 77.10% 4.20% 10.42% 8.33% NA
Intermediate  90 33.30% 6.70% 27.78% 32.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1124448492 T -> DEL N N silent_mutation Average:41.52; most accessible tissue: Callus, score: 71.848 N N N N
vg1124448492 T -> G LOC_Os11g40870.1 upstream_gene_variant ; 728.0bp to feature; MODIFIER silent_mutation Average:41.52; most accessible tissue: Callus, score: 71.848 N N N N
vg1124448492 T -> G LOC_Os11g40860.1 downstream_gene_variant ; 2768.0bp to feature; MODIFIER silent_mutation Average:41.52; most accessible tissue: Callus, score: 71.848 N N N N
vg1124448492 T -> G LOC_Os11g40860-LOC_Os11g40870 intergenic_region ; MODIFIER silent_mutation Average:41.52; most accessible tissue: Callus, score: 71.848 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1124448492 9.43E-06 1.97E-07 mr1309 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124448492 NA 7.45E-06 mr1165_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124448492 NA 3.32E-06 mr1238_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124448492 NA 4.71E-06 mr1268_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124448492 NA 7.23E-08 mr1477_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124448492 NA 3.66E-09 mr1609_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124448492 NA 1.88E-06 mr1900_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124448492 NA 8.68E-06 mr1925_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251