Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124341241:

Variant ID: vg1124341241 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 24341241
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:


TGCACACATGCATGGTACCCACCCTGGATCCTCAACGATGGCTCGTACCGTATATGCACGCCTTGTTATTAGTGACAAATCGTTGCTTCAATTAGTATGG[G/A]
TCTACATATAAACCATATGATTTGTGTTAACATTGGATGGCATTAATTTAGATCACCACATTCCCAATTTTGAAATAAACCATATGACGATGGTTTATAG

Reverse complement sequence

CTATAAACCATCGTCATATGGTTTATTTCAAAATTGGGAATGTGGTGATCTAAATTAATGCCATCCAATGTTAACACAAATCATATGGTTTATATGTAGA[C/T]
CCATACTAATTGAAGCAACGATTTGTCACTAATAACAAGGCGTGCATATACGGTACGAGCCATCGTTGAGGATCCAGGGTGGGTACCATGCATGTGTGCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.20% 11.60% 0.57% 7.68% NA
All Indica  2759 75.10% 13.10% 0.58% 11.20% NA
All Japonica  1512 98.70% 0.70% 0.00% 0.60% NA
Aus  269 40.50% 58.70% 0.00% 0.74% NA
Indica I  595 91.40% 6.40% 0.00% 2.18% NA
Indica II  465 86.90% 11.80% 0.22% 1.08% NA
Indica III  913 55.00% 18.50% 1.10% 25.41% NA
Indica Intermediate  786 79.10% 12.70% 0.64% 7.51% NA
Temperate Japonica  767 98.80% 0.40% 0.00% 0.78% NA
Tropical Japonica  504 99.00% 0.60% 0.00% 0.40% NA
Japonica Intermediate  241 97.50% 2.10% 0.00% 0.41% NA
VI/Aromatic  96 38.50% 10.40% 11.46% 39.58% NA
Intermediate  90 86.70% 7.80% 0.00% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1124341241 G -> A LOC_Os11g40700-LOC_Os11g40720 intergenic_region ; MODIFIER silent_mutation Average:44.362; most accessible tissue: Zhenshan97 young leaf, score: 80.325 N N N N
vg1124341241 G -> DEL N N silent_mutation Average:44.362; most accessible tissue: Zhenshan97 young leaf, score: 80.325 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1124341241 8.10E-12 1.93E-13 mr1238 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124341241 5.82E-08 5.66E-09 mr1309 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124341241 1.19E-06 4.23E-08 mr1484 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124341241 2.72E-06 1.18E-07 mr1841 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124341241 2.22E-07 2.22E-07 mr1900 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124341241 1.01E-09 3.07E-11 mr1238_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124341241 6.09E-10 8.72E-12 mr1484_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124341241 1.62E-11 1.58E-13 mr1841_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124341241 7.89E-06 2.25E-07 mr1900_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124341241 1.81E-10 1.81E-10 mr1945_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251