\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124340538:

Variant ID: vg1124340538 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 24340538
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.09, C: 0.01, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


TACTTTCCAATTTCTTTTCACAAATATTCCACCTAATGCTAAAATTTAATTAAATAATTAGTTTTCCACTCAACACATTACTACACAAGGTTAAAACTTC[G/A]
ACACAATTTTTACTGTTGATTACAATATCAAAATAATACACCATTCAAAATACTCGAATTTTAAAAATTAAGAATGGTACCATGAATTCTATGATAAAAA

Reverse complement sequence

TTTTTATCATAGAATTCATGGTACCATTCTTAATTTTTAAAATTCGAGTATTTTGAATGGTGTATTATTTTGATATTGTAATCAACAGTAAAAATTGTGT[C/T]
GAAGTTTTAACCTTGTGTAGTAATGTGTTGAGTGGAAAACTAATTATTTAATTAAATTTTAGCATTAGGTGGAATATTTGTGAAAAGAAATTGGAAAGTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.80% 12.10% 0.11% 0.00% NA
All Indica  2759 91.50% 8.40% 0.07% 0.00% NA
All Japonica  1512 92.40% 7.50% 0.13% 0.00% NA
Aus  269 24.20% 75.80% 0.00% 0.00% NA
Indica I  595 81.70% 18.00% 0.34% 0.00% NA
Indica II  465 89.70% 10.30% 0.00% 0.00% NA
Indica III  913 98.20% 1.80% 0.00% 0.00% NA
Indica Intermediate  786 92.10% 7.90% 0.00% 0.00% NA
Temperate Japonica  767 85.80% 14.00% 0.26% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 97.90% 2.10% 0.00% 0.00% NA
VI/Aromatic  96 87.50% 11.50% 1.04% 0.00% NA
Intermediate  90 88.90% 11.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1124340538 G -> A LOC_Os11g40700-LOC_Os11g40720 intergenic_region ; MODIFIER silent_mutation Average:28.548; most accessible tissue: Callus, score: 63.166 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1124340538 1.70E-10 1.36E-09 mr1238 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124340538 4.19E-08 2.93E-07 mr1309 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124340538 NA 6.18E-08 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124340538 NA 3.17E-07 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124340538 5.07E-06 7.84E-07 mr1841 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124340538 5.69E-06 2.17E-06 mr1238_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124340538 5.03E-08 6.65E-08 mr1484_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124340538 NA 7.29E-06 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124340538 5.25E-08 7.24E-10 mr1841_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251