\
| Variant ID: vg1124335591 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 24335591 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, C: 0.06, others allele: 0.00, population size: 218. )
ATGAACACATAAATAAACAGATAACACAAATAGAGCCCGCACATTGCCGTAGATTTTTTAAGATACAGGAAGCTTTTATTGAACCCAGCCAACAACTATA[G/C]
CAAGAAAATACAAAAGCACTGAAAGCCCGAGCGTCACCGTAAACGATTAGATGGATCCAACTCAAGGCATGCAGGCTTGGAAGATATGGTGGTCCTTGTA
TACAAGGACCACCATATCTTCCAAGCCTGCATGCCTTGAGTTGGATCCATCTAATCGTTTACGGTGACGCTCGGGCTTTCAGTGCTTTTGTATTTTCTTG[C/G]
TATAGTTGTTGGCTGGGTTCAATAAAAGCTTCCTGTATCTTAAAAAATCTACGGCAATGTGCGGGCTCTATTTGTGTTATCTGTTTATTTATGTGTTCAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.90% | 14.50% | 0.15% | 1.50% | NA |
| All Indica | 2759 | 86.00% | 13.40% | 0.00% | 0.58% | NA |
| All Japonica | 1512 | 91.30% | 8.60% | 0.07% | 0.00% | NA |
| Aus | 269 | 19.00% | 58.70% | 1.86% | 20.45% | NA |
| Indica I | 595 | 93.60% | 6.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 88.20% | 11.60% | 0.00% | 0.22% | NA |
| Indica III | 913 | 80.90% | 18.30% | 0.00% | 0.77% | NA |
| Indica Intermediate | 786 | 84.70% | 14.20% | 0.00% | 1.02% | NA |
| Temperate Japonica | 767 | 96.90% | 3.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 84.30% | 15.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 88.40% | 11.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 11.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1124335591 | G -> DEL | N | N | silent_mutation | Average:43.521; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg1124335591 | G -> C | LOC_Os11g40700-LOC_Os11g40720 | intergenic_region ; MODIFIER | silent_mutation | Average:43.521; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1124335591 | 1.26E-09 | 2.27E-11 | mr1238 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124335591 | 2.19E-07 | 3.12E-08 | mr1309 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124335591 | NA | 4.13E-06 | mr1484 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124335591 | NA | 6.88E-07 | mr1841 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124335591 | 1.38E-06 | 1.38E-06 | mr1900 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124335591 | 1.25E-07 | 1.98E-08 | mr1238_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124335591 | 9.53E-08 | 9.05E-09 | mr1484_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124335591 | 1.04E-08 | 1.77E-10 | mr1841_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124335591 | 1.49E-07 | 1.49E-07 | mr1945_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |