Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124335549:

Variant ID: vg1124335549 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 24335549
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, A: 0.02, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

AGGTGATATTCCACGATGTGAATTTTCTGCATCACATACTGAATGAACACATAAATAAACAGATAACACAAATAGAGCCCGCACATTGCCGTAGATTTTT[T/A]
AAGATACAGGAAGCTTTTATTGAACCCAGCCAACAACTATAGCAAGAAAATACAAAAGCACTGAAAGCCCGAGCGTCACCGTAAACGATTAGATGGATCC

Reverse complement sequence

GGATCCATCTAATCGTTTACGGTGACGCTCGGGCTTTCAGTGCTTTTGTATTTTCTTGCTATAGTTGTTGGCTGGGTTCAATAAAAGCTTCCTGTATCTT[A/T]
AAAAATCTACGGCAATGTGCGGGCTCTATTTGTGTTATCTGTTTATTTATGTGTTCATTCAGTATGTGATGCAGAAAATTCACATCGTGGAATATCACCT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.90%	8.60%	0.06%	1.44%	NA
All Indica	2759	95.10%	4.30%	0.00%	0.58%	NA
All Japonica	1512	91.60%	8.40%	0.00%	0.00%	NA
Aus	269	28.60%	51.30%	0.74%	19.33%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	90.30%	9.50%	0.00%	0.22%	NA
Indica III	913	98.50%	0.80%	0.00%	0.77%	NA
Indica Intermediate	786	90.60%	8.40%	0.00%	1.02%	NA
Temperate Japonica	767	97.30%	2.70%	0.00%	0.00%	NA
Tropical Japonica	504	84.30%	15.70%	0.00%	0.00%	NA
Japonica Intermediate	241	88.80%	11.20%	0.00%	0.00%	NA
VI/Aromatic	96	83.30%	16.70%	0.00%	0.00%	NA
Intermediate	90	91.10%	7.80%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1124335549	T -> A	LOC_Os11g40700-LOC_Os11g40720	intergenic_region ; MODIFIER	silent_mutation	Average:41.726; most accessible tissue: Callus, score: 66.664	N	N	N	N
vg1124335549	T -> DEL	N	N	silent_mutation	Average:41.726; most accessible tissue: Callus, score: 66.664	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1124335549	2.86E-20	1.64E-23	mr1238	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124335549	4.14E-17	4.55E-20	mr1309	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124335549	3.67E-09	3.44E-10	mr1484	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124335549	1.72E-13	1.97E-16	mr1841	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124335549	2.16E-10	2.16E-10	mr1900	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124335549	2.88E-13	3.95E-15	mr1238_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124335549	1.64E-13	3.06E-15	mr1484_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124335549	2.46E-06	8.95E-07	mr1609_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124335549	5.66E-18	8.29E-21	mr1841_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124335549	1.76E-10	3.25E-12	mr1900_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124335549	1.44E-08	1.44E-08	mr1945_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251