Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124331341:

Variant ID: vg1124331341 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 24331341
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.89, T: 0.11, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:

AAATCGATCAAGAAGGTTAGTCGTCGTTCCGCTATATCGACTAATTTACTTTTATAACAAGCATCAGGCCCAAAAACATTGAATCTCAAGCCAATACTAG[T/C]
GCGGGCCAAATTTAGATGGGCGGGCCTACTTGGGCTGTATCCCCAAACCTGGCTACAGTGGGCCGAACTTTTCTAGACAAAGGACATCATTTTATTACGT

Reverse complement sequence

ACGTAATAAAATGATGTCCTTTGTCTAGAAAAGTTCGGCCCACTGTAGCCAGGTTTGGGGATACAGCCCAAGTAGGCCCGCCCATCTAAATTTGGCCCGC[A/G]
CTAGTATTGGCTTGAGATTCAATGTTTTTGGGCCTGATGCTTGTTATAAAAGTAAATTAGTCGATATAGCGGAACGACGACTAACCTTCTTGATCGATTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.90%	28.60%	0.13%	1.44%	NA
All Indica	2759	93.90%	5.50%	0.04%	0.58%	NA
All Japonica	1512	34.50%	65.40%	0.07%	0.00%	NA
Aus	269	19.70%	60.60%	0.37%	19.33%	NA
Indica I	595	98.80%	1.20%	0.00%	0.00%	NA
Indica II	465	89.70%	10.10%	0.00%	0.22%	NA
Indica III	913	97.20%	2.10%	0.00%	0.77%	NA
Indica Intermediate	786	88.90%	9.90%	0.13%	1.02%	NA
Temperate Japonica	767	12.30%	87.60%	0.13%	0.00%	NA
Tropical Japonica	504	68.30%	31.70%	0.00%	0.00%	NA
Japonica Intermediate	241	34.90%	65.10%	0.00%	0.00%	NA
VI/Aromatic	96	72.90%	26.00%	1.04%	0.00%	NA
Intermediate	90	73.30%	24.40%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1124331341	T -> DEL	N	N	silent_mutation	Average:47.582; most accessible tissue: Callus, score: 90.528	N	N	N	N
vg1124331341	T -> C	LOC_Os11g40700-LOC_Os11g40720	intergenic_region ; MODIFIER	silent_mutation	Average:47.582; most accessible tissue: Callus, score: 90.528	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1124331341	6.47E-13	3.25E-14	mr1238	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124331341	6.59E-11	3.50E-13	mr1309	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124331341	NA	9.94E-06	mr1377	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124331341	NA	1.63E-07	mr1555	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124331341	NA	4.74E-10	mr1746	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124331341	3.58E-09	1.36E-09	mr1841	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124331341	4.60E-09	4.60E-09	mr1900	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124331341	2.63E-09	1.80E-09	mr1238_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124331341	6.28E-10	3.26E-10	mr1484_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124331341	1.41E-13	7.84E-14	mr1841_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124331341	3.50E-08	1.61E-07	mr1900_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124331341	3.42E-07	3.42E-07	mr1945_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251