\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124331341:

Variant ID: vg1124331341 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 24331341
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.89, T: 0.11, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


AAATCGATCAAGAAGGTTAGTCGTCGTTCCGCTATATCGACTAATTTACTTTTATAACAAGCATCAGGCCCAAAAACATTGAATCTCAAGCCAATACTAG[T/C]
GCGGGCCAAATTTAGATGGGCGGGCCTACTTGGGCTGTATCCCCAAACCTGGCTACAGTGGGCCGAACTTTTCTAGACAAAGGACATCATTTTATTACGT

Reverse complement sequence

ACGTAATAAAATGATGTCCTTTGTCTAGAAAAGTTCGGCCCACTGTAGCCAGGTTTGGGGATACAGCCCAAGTAGGCCCGCCCATCTAAATTTGGCCCGC[A/G]
CTAGTATTGGCTTGAGATTCAATGTTTTTGGGCCTGATGCTTGTTATAAAAGTAAATTAGTCGATATAGCGGAACGACGACTAACCTTCTTGATCGATTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.90% 28.60% 0.13% 1.44% NA
All Indica  2759 93.90% 5.50% 0.04% 0.58% NA
All Japonica  1512 34.50% 65.40% 0.07% 0.00% NA
Aus  269 19.70% 60.60% 0.37% 19.33% NA
Indica I  595 98.80% 1.20% 0.00% 0.00% NA
Indica II  465 89.70% 10.10% 0.00% 0.22% NA
Indica III  913 97.20% 2.10% 0.00% 0.77% NA
Indica Intermediate  786 88.90% 9.90% 0.13% 1.02% NA
Temperate Japonica  767 12.30% 87.60% 0.13% 0.00% NA
Tropical Japonica  504 68.30% 31.70% 0.00% 0.00% NA
Japonica Intermediate  241 34.90% 65.10% 0.00% 0.00% NA
VI/Aromatic  96 72.90% 26.00% 1.04% 0.00% NA
Intermediate  90 73.30% 24.40% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1124331341 T -> DEL N N silent_mutation Average:47.582; most accessible tissue: Callus, score: 90.528 N N N N
vg1124331341 T -> C LOC_Os11g40700-LOC_Os11g40720 intergenic_region ; MODIFIER silent_mutation Average:47.582; most accessible tissue: Callus, score: 90.528 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1124331341 6.47E-13 3.25E-14 mr1238 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124331341 6.59E-11 3.50E-13 mr1309 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124331341 NA 9.94E-06 mr1377 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124331341 NA 1.63E-07 mr1555 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124331341 NA 4.74E-10 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124331341 3.58E-09 1.36E-09 mr1841 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124331341 4.60E-09 4.60E-09 mr1900 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124331341 2.63E-09 1.80E-09 mr1238_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124331341 6.28E-10 3.26E-10 mr1484_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124331341 1.41E-13 7.84E-14 mr1841_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124331341 3.50E-08 1.61E-07 mr1900_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124331341 3.42E-07 3.42E-07 mr1945_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251