\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124328383:

Variant ID: vg1124328383 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 24328383
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.89, T: 0.11, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


GCGTCAATCGCTAGTCCTCGGCAGGGAGAAGGCAGTGGCGACAGCTTGGGAGGTCGGACGGAAAGGACCTCCTCGACAGCAGTGGTGGCGGCCCTAGGGG[T/C]
AGTGCCGGCCCTGAGCGCCAGTGCAAGGTTCTTGCGAGGAGGAAACAATTCAGATGGAGGCGAATCCCATCAGCAACTGTGACCCTAGGAGCGGTGGAGG

Reverse complement sequence

CCTCCACCGCTCCTAGGGTCACAGTTGCTGATGGGATTCGCCTCCATCTGAATTGTTTCCTCCTCGCAAGAACCTTGCACTGGCGCTCAGGGCCGGCACT[A/G]
CCCCTAGGGCCGCCACCACTGCTGTCGAGGAGGTCCTTTCCGTCCGACCTCCCAAGCTGTCGCCACTGCCTTCTCCCTGCCGAGGACTAGCGATTGACGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.70% 23.60% 0.25% 1.48% NA
All Indica  2759 94.60% 4.90% 0.00% 0.58% NA
All Japonica  1512 50.30% 49.50% 0.26% 0.00% NA
Aus  269 24.20% 53.20% 2.60% 20.07% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 87.70% 12.00% 0.00% 0.22% NA
Indica III  913 97.60% 1.60% 0.00% 0.77% NA
Indica Intermediate  786 91.30% 7.60% 0.00% 1.02% NA
Temperate Japonica  767 56.50% 43.00% 0.52% 0.00% NA
Tropical Japonica  504 35.70% 64.30% 0.00% 0.00% NA
Japonica Intermediate  241 61.00% 39.00% 0.00% 0.00% NA
VI/Aromatic  96 31.20% 68.80% 0.00% 0.00% NA
Intermediate  90 71.10% 27.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1124328383 T -> DEL N N silent_mutation Average:62.1; most accessible tissue: Zhenshan97 young leaf, score: 85.715 N N N N
vg1124328383 T -> C LOC_Os11g40700.1 upstream_gene_variant ; 3257.0bp to feature; MODIFIER silent_mutation Average:62.1; most accessible tissue: Zhenshan97 young leaf, score: 85.715 N N N N
vg1124328383 T -> C LOC_Os11g40700-LOC_Os11g40720 intergenic_region ; MODIFIER silent_mutation Average:62.1; most accessible tissue: Zhenshan97 young leaf, score: 85.715 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1124328383 5.24E-06 NA mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124328383 8.17E-09 NA mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124328383 2.48E-08 NA mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124328383 9.22E-06 NA mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124328383 NA 1.32E-08 mr1707_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124328383 1.36E-08 NA mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124328383 2.22E-08 NA mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124328383 6.82E-08 NA mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251