Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124328383:

Variant ID: vg1124328383 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 24328383
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.89, T: 0.11, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:

GCGTCAATCGCTAGTCCTCGGCAGGGAGAAGGCAGTGGCGACAGCTTGGGAGGTCGGACGGAAAGGACCTCCTCGACAGCAGTGGTGGCGGCCCTAGGGG[T/C]
AGTGCCGGCCCTGAGCGCCAGTGCAAGGTTCTTGCGAGGAGGAAACAATTCAGATGGAGGCGAATCCCATCAGCAACTGTGACCCTAGGAGCGGTGGAGG

Reverse complement sequence

CCTCCACCGCTCCTAGGGTCACAGTTGCTGATGGGATTCGCCTCCATCTGAATTGTTTCCTCCTCGCAAGAACCTTGCACTGGCGCTCAGGGCCGGCACT[A/G]
CCCCTAGGGCCGCCACCACTGCTGTCGAGGAGGTCCTTTCCGTCCGACCTCCCAAGCTGTCGCCACTGCCTTCTCCCTGCCGAGGACTAGCGATTGACGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.70%	23.60%	0.25%	1.48%	NA
All Indica	2759	94.60%	4.90%	0.00%	0.58%	NA
All Japonica	1512	50.30%	49.50%	0.26%	0.00%	NA
Aus	269	24.20%	53.20%	2.60%	20.07%	NA
Indica I	595	99.50%	0.50%	0.00%	0.00%	NA
Indica II	465	87.70%	12.00%	0.00%	0.22%	NA
Indica III	913	97.60%	1.60%	0.00%	0.77%	NA
Indica Intermediate	786	91.30%	7.60%	0.00%	1.02%	NA
Temperate Japonica	767	56.50%	43.00%	0.52%	0.00%	NA
Tropical Japonica	504	35.70%	64.30%	0.00%	0.00%	NA
Japonica Intermediate	241	61.00%	39.00%	0.00%	0.00%	NA
VI/Aromatic	96	31.20%	68.80%	0.00%	0.00%	NA
Intermediate	90	71.10%	27.80%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1124328383	T -> DEL	N	N	silent_mutation	Average:62.1; most accessible tissue: Zhenshan97 young leaf, score: 85.715	N	N	N	N
vg1124328383	T -> C	LOC_Os11g40700.1	upstream_gene_variant ; 3257.0bp to feature; MODIFIER	silent_mutation	Average:62.1; most accessible tissue: Zhenshan97 young leaf, score: 85.715	N	N	N	N
vg1124328383	T -> C	LOC_Os11g40700-LOC_Os11g40720	intergenic_region ; MODIFIER	silent_mutation	Average:62.1; most accessible tissue: Zhenshan97 young leaf, score: 85.715	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1124328383	5.24E-06	NA	mr1841	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124328383	8.17E-09	NA	mr1238_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124328383	2.48E-08	NA	mr1484_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124328383	9.22E-06	NA	mr1609_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124328383	NA	1.32E-08	mr1707_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124328383	1.36E-08	NA	mr1841_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124328383	2.22E-08	NA	mr1900_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124328383	6.82E-08	NA	mr1945_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251