\
| Variant ID: vg1124305277 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 24305277 |
| Reference Allele: G | Alternative Allele: A,T |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 113. )
ATAATAAAACATGATTAATACTTTATACGTGACTTATCTTTTTAATTTTTTTTAAATAAGACGGACGTTGGACACAAAAATTCAGGATTTTTTTCTTGAC[G/A,T]
GAGGGAGTACTGGTCACTGTATTCTGTTGAATGCAAGCCCGTCTCCTGCTCTCTTCTCTAACAACACTTTAGCAAAACTTTAAAAATACTTTTTTATAAA
TTTATAAAAAAGTATTTTTAAAGTTTTGCTAAAGTGTTGTTAGAGAAGAGAGCAGGAGACGGGCTTGCATTCAACAGAATACAGTGACCAGTACTCCCTC[C/T,A]
GTCAAGAAAAAAATCCTGAATTTTTGTGTCCAACGTCCGTCTTATTTAAAAAAAATTAAAAAGATAAGTCACGTATAAAGTATTAATCATGTTTTATTAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.70% | 25.20% | 3.07% | 4.17% | T: 2.86% |
| All Indica | 2759 | 48.50% | 37.30% | 3.33% | 6.85% | T: 3.99% |
| All Japonica | 1512 | 94.20% | 2.10% | 3.37% | 0.20% | T: 0.20% |
| Aus | 269 | 66.20% | 25.30% | 0.37% | 0.74% | T: 7.43% |
| Indica I | 595 | 60.80% | 19.20% | 6.89% | 7.73% | T: 5.38% |
| Indica II | 465 | 46.90% | 36.60% | 3.01% | 12.04% | T: 1.51% |
| Indica III | 913 | 41.40% | 49.80% | 1.10% | 2.63% | T: 5.04% |
| Indica Intermediate | 786 | 48.50% | 36.90% | 3.44% | 8.02% | T: 3.18% |
| Temperate Japonica | 767 | 91.90% | 1.30% | 6.39% | 0.13% | T: 0.26% |
| Tropical Japonica | 504 | 96.20% | 3.60% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 97.10% | 1.20% | 0.83% | 0.41% | T: 0.41% |
| VI/Aromatic | 96 | 49.00% | 51.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 76.70% | 16.70% | 1.11% | 3.33% | T: 2.22% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1124305277 | G -> T | LOC_Os11g40690.1 | intron_variant ; MODIFIER | silent_mutation | Average:26.83; most accessible tissue: Callus, score: 61.881 | N | N | N | N |
| vg1124305277 | G -> A | LOC_Os11g40690.1 | intron_variant ; MODIFIER | silent_mutation | Average:26.83; most accessible tissue: Callus, score: 61.881 | N | N | N | N |
| vg1124305277 | G -> DEL | N | N | silent_mutation | Average:26.83; most accessible tissue: Callus, score: 61.881 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1124305277 | NA | 2.85E-06 | mr1309 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124305277 | NA | 2.54E-06 | mr1115_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124305277 | NA | 2.53E-07 | mr1205_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124305277 | NA | 1.02E-06 | mr1205_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124305277 | 9.33E-06 | 1.97E-06 | mr1209_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124305277 | 2.73E-06 | 2.72E-06 | mr1209_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124305277 | NA | 1.80E-07 | mr1238_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124305277 | NA | 2.73E-06 | mr1376_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124305277 | NA | 2.20E-06 | mr1431_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124305277 | NA | 3.42E-06 | mr1484_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124305277 | NA | 3.22E-07 | mr1566_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124305277 | NA | 1.65E-10 | mr1609_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124305277 | NA | 8.03E-06 | mr1735_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124305277 | NA | 2.13E-07 | mr1795_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124305277 | NA | 2.24E-07 | mr1900_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124305277 | NA | 1.31E-07 | mr1909_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |