\
| Variant ID: vg1124304377 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 24304377 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.08, others allele: 0.00, population size: 115. )
GCATTGAAGTTGGCACTAAATAGATGAATTCATAAATATGGAAATTTCCCGACCGTTTCTGTTCGTTTTCCAAAAAAATAATAAAATAATGTACTGTTTC[C/T]
GACCATTTCCGACCGTTTTCATCCCTATCCATGGGGGAGTACTGGGTTCGTACCCACTGAACACGTATCTTAATACTAAATGACAGGTTTTAAACTGAAA
TTTCAGTTTAAAACCTGTCATTTAGTATTAAGATACGTGTTCAGTGGGTACGAACCCAGTACTCCCCCATGGATAGGGATGAAAACGGTCGGAAATGGTC[G/A]
GAAACAGTACATTATTTTATTATTTTTTTGGAAAACGAACAGAAACGGTCGGGAAATTTCCATATTTATGAATTCATCTATTTAGTGCCAACTTCAATGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.10% | 29.30% | 1.65% | 0.00% | NA |
| All Indica | 2759 | 53.60% | 44.00% | 2.39% | 0.00% | NA |
| All Japonica | 1512 | 97.80% | 2.10% | 0.13% | 0.00% | NA |
| Aus | 269 | 69.10% | 29.70% | 1.12% | 0.00% | NA |
| Indica I | 595 | 70.90% | 26.90% | 2.18% | 0.00% | NA |
| Indica II | 465 | 51.80% | 44.10% | 4.09% | 0.00% | NA |
| Indica III | 913 | 43.20% | 55.20% | 1.64% | 0.00% | NA |
| Indica Intermediate | 786 | 53.80% | 43.80% | 2.42% | 0.00% | NA |
| Temperate Japonica | 767 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 96.20% | 3.60% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 1.20% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 50.00% | 46.90% | 3.12% | 0.00% | NA |
| Intermediate | 90 | 80.00% | 15.60% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1124304377 | C -> T | LOC_Os11g40690.1 | intron_variant ; MODIFIER | silent_mutation | Average:29.617; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1124304377 | NA | 6.80E-06 | mr1084_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124304377 | NA | 1.90E-06 | mr1115_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124304377 | NA | 2.45E-06 | mr1205_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124304377 | NA | 4.90E-06 | mr1209_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124304377 | 3.66E-06 | 3.66E-06 | mr1209_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124304377 | NA | 8.25E-08 | mr1238_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124304377 | NA | 1.15E-06 | mr1376_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124304377 | NA | 7.67E-07 | mr1431_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124304377 | NA | 8.16E-07 | mr1484_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124304377 | NA | 6.80E-06 | mr1566_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124304377 | NA | 3.20E-10 | mr1609_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124304377 | NA | 7.61E-06 | mr1735_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124304377 | NA | 1.61E-08 | mr1795_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124304377 | NA | 1.41E-06 | mr1900_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124304377 | NA | 4.15E-08 | mr1909_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124304377 | NA | 9.84E-06 | mr1909_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |