\
| Variant ID: vg1124303443 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 24303443 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, T: 0.02, others allele: 0.00, population size: 209. )
CATGCTTAAAAAACATTTGATGACGAATCAAGTCATAATAAAATAAATGATAATTATATAAATTTTTTGAATAAGACGAATGGTCAAACGTTGGATAAAA[A/T]
TTCAACGGCGTCATACATTAAAATATGGAGGTAGTAGTACTTTTGTTTGATGCAAAGATAAATGTTTACCCCCTAAATCGGGTGTCTTAACATTCAATTT
AAATTGAATGTTAAGACACCCGATTTAGGGGGTAAACATTTATCTTTGCATCAAACAAAAGTACTACTACCTCCATATTTTAATGTATGACGCCGTTGAA[T/A]
TTTTATCCAACGTTTGACCATTCGTCTTATTCAAAAAATTTATATAATTATCATTTATTTTATTATGACTTGATTCGTCATCAAATGTTTTTTAAGCATG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.60% | 25.20% | 0.17% | 0.00% | NA |
| All Indica | 2759 | 61.60% | 38.20% | 0.22% | 0.00% | NA |
| All Japonica | 1512 | 99.00% | 0.90% | 0.07% | 0.00% | NA |
| Aus | 269 | 75.10% | 24.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 74.80% | 24.70% | 0.50% | 0.00% | NA |
| Indica II | 465 | 62.80% | 37.00% | 0.22% | 0.00% | NA |
| Indica III | 913 | 52.50% | 47.40% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 61.50% | 38.40% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.40% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 52.10% | 47.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 12.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1124303443 | A -> T | LOC_Os11g40690.1 | intron_variant ; MODIFIER | silent_mutation | Average:50.113; most accessible tissue: Callus, score: 85.875 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1124303443 | NA | 1.08E-06 | mr1084_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124303443 | NA | 1.43E-06 | mr1115_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124303443 | NA | 4.80E-08 | mr1205_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124303443 | NA | 5.42E-08 | mr1205_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124303443 | 1.26E-06 | 2.70E-07 | mr1209_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124303443 | 3.63E-07 | 3.63E-07 | mr1209_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124303443 | NA | 3.99E-06 | mr1304_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124303443 | NA | 2.32E-07 | mr1376_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124303443 | NA | 1.44E-07 | mr1376_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124303443 | NA | 1.24E-07 | mr1431_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124303443 | NA | 1.35E-07 | mr1431_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124303443 | NA | 7.81E-06 | mr1696_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124303443 | NA | 7.49E-06 | mr1735_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124303443 | NA | 4.01E-06 | mr1735_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124303443 | NA | 7.84E-06 | mr1795_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124303443 | NA | 4.41E-08 | mr1824_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124303443 | NA | 3.94E-06 | mr1869_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124303443 | NA | 4.74E-08 | mr1909_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124303443 | NA | 1.02E-07 | mr1921_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124303443 | NA | 5.80E-06 | mr1951_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124303443 | NA | 8.85E-06 | mr1968_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |