Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124292988:

Variant ID: vg1124292988 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 24292988
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:

GAGGCCGGAGATGTAATACATTTCTATTATCTAAAAAAACACCTTTGATCACAGGGAGGTTATATTCACATTTCTGAAGAGAGAGAGAAGCTTCGATGGT[C/T]
GAAGCTTGTGCATGATTATACATAGTAGTTGCTAATGTATATACATACACAAGCCATGTGATCGATCAGCAACGGATGTTGATGTGGACTCTAGATGATT

Reverse complement sequence

AATCATCTAGAGTCCACATCAACATCCGTTGCTGATCGATCACATGGCTTGTGTATGTATATACATTAGCAACTACTATGTATAATCATGCACAAGCTTC[G/A]
ACCATCGAAGCTTCTCTCTCTCTTCAGAAATGTGAATATAACCTCCCTGTGATCAAAGGTGTTTTTTTAGATAATAGAAATGTATTACATCTCCGGCCTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.60%	34.70%	0.30%	4.40%	NA
All Indica	2759	49.50%	49.80%	0.14%	0.54%	NA
All Japonica	1512	74.30%	14.30%	0.66%	10.78%	NA
Aus	269	89.60%	2.60%	0.00%	7.81%	NA
Indica I	595	22.20%	77.80%	0.00%	0.00%	NA
Indica II	465	42.20%	57.20%	0.00%	0.65%	NA
Indica III	913	70.60%	28.50%	0.11%	0.77%	NA
Indica Intermediate	786	49.90%	49.10%	0.38%	0.64%	NA
Temperate Japonica	767	87.70%	8.10%	0.26%	3.91%	NA
Tropical Japonica	504	66.10%	13.10%	1.19%	19.64%	NA
Japonica Intermediate	241	48.50%	36.50%	0.83%	14.11%	NA
VI/Aromatic	96	91.70%	7.30%	0.00%	1.04%	NA
Intermediate	90	52.20%	38.90%	0.00%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1124292988	C -> T	LOC_Os11g40680-LOC_Os11g40690	intergenic_region ; MODIFIER	silent_mutation	Average:44.281; most accessible tissue: Callus, score: 76.872	N	N	N	N
vg1124292988	C -> DEL	N	N	silent_mutation	Average:44.281; most accessible tissue: Callus, score: 76.872	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1124292988	NA	2.96E-06	mr1280	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124292988	NA	1.39E-06	mr1807	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124292988	NA	3.01E-07	mr1183_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124292988	7.54E-06	7.54E-06	mr1466_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124292988	NA	8.47E-06	mr1492_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124292988	NA	4.63E-06	mr1556_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124292988	NA	2.62E-06	mr1764_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124292988	NA	2.83E-06	mr1779_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124292988	NA	3.87E-06	mr1788_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124292988	NA	7.61E-07	mr1813_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124292988	7.62E-07	7.62E-07	mr1824_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124292988	2.11E-06	2.11E-06	mr1831_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124292988	7.64E-06	7.64E-06	mr1840_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124292988	NA	2.96E-07	mr1894_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251