Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124277631:

Variant ID: vg1124277631 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 24277631
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACTGCGCCAAACCTCACCCTACCGAGCGCTCTGCCACTGGGTGGGAGGGGAGGCGGCGGTGGTCTGGTGACGGCCTGGCGGCGGTGGATCCTCGGGGTGA[C/T]
GGCGGCAGCAGTGGCGGTTCTGGTAGACGGTGACGGTGAGCAGCGGTGGTGTCGGTCTTGTTCTTTCAATGTTTGTTGTGTGATGTCTGTGATTGATGTT

Reverse complement sequence

AACATCAATCACAGACATCACACAACAAACATTGAAAGAACAAGACCGACACCACCGCTGCTCACCGTCACCGTCTACCAGAACCGCCACTGCTGCCGCC[G/A]
TCACCCCGAGGATCCACCGCCGCCAGGCCGTCACCAGACCACCGCCGCCTCCCCTCCCACCCAGTGGCAGAGCGCTCGGTAGGGTGAGGTTTGGCGCAGT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.80%	42.60%	1.82%	0.78%	NA
All Indica	2759	82.20%	13.40%	3.01%	1.34%	NA
All Japonica	1512	17.30%	82.60%	0.07%	0.00%	NA
Aus	269	3.00%	97.00%	0.00%	0.00%	NA
Indica I	595	92.10%	6.60%	1.18%	0.17%	NA
Indica II	465	86.00%	4.90%	7.31%	1.72%	NA
Indica III	913	74.30%	23.10%	1.31%	1.31%	NA
Indica Intermediate	786	81.70%	12.50%	3.82%	2.04%	NA
Temperate Japonica	767	12.10%	87.90%	0.00%	0.00%	NA
Tropical Japonica	504	13.70%	86.10%	0.20%	0.00%	NA
Japonica Intermediate	241	41.50%	58.50%	0.00%	0.00%	NA
VI/Aromatic	96	13.50%	86.50%	0.00%	0.00%	NA
Intermediate	90	43.30%	54.40%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1124277631	C -> T	LOC_Os11g40674.1	downstream_gene_variant ; 3376.0bp to feature; MODIFIER	silent_mutation	Average:63.469; most accessible tissue: Minghui63 young leaf, score: 75.479	N	N	N	N
vg1124277631	C -> T	LOC_Os11g40680.1	downstream_gene_variant ; 991.0bp to feature; MODIFIER	silent_mutation	Average:63.469; most accessible tissue: Minghui63 young leaf, score: 75.479	N	N	N	N
vg1124277631	C -> T	LOC_Os11g40674-LOC_Os11g40680	intergenic_region ; MODIFIER	silent_mutation	Average:63.469; most accessible tissue: Minghui63 young leaf, score: 75.479	N	N	N	N
vg1124277631	C -> DEL	N	N	silent_mutation	Average:63.469; most accessible tissue: Minghui63 young leaf, score: 75.479	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1124277631	NA	2.44E-06	mr1280	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124277631	NA	5.80E-08	mr1321	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124277631	NA	2.44E-06	mr1807	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124277631	NA	2.25E-07	mr1321_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124277631	NA	2.89E-06	mr1492_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124277631	NA	4.28E-06	mr1764_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124277631	NA	5.35E-06	mr1779_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124277631	NA	7.11E-06	mr1813_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124277631	4.06E-06	4.06E-06	mr1824_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124277631	7.32E-06	7.32E-06	mr1831_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124277631	4.78E-06	4.78E-06	mr1840_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124277631	NA	1.33E-06	mr1894_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251