Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124276697:

Variant ID: vg1124276697 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 24276697
Reference Allele: TAlternative Allele: C,G
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACTCGACATACGATCGATGTGCGGTGCGCCAATGTGCTGCACGCCCGCGCCGTGCTCTTCCGACGCCGACGACCGATATGAGCAAAGATGAATTGGGAAG[T/C,G]
TAGGGTTGTTCAGCTAGTCAACATTTTGACCACAATAACAAGGGTGAACCTATAGATGGCCAAAAGGCCCGCTCGACACAGCCCGGCCTAGGCACGGCCA

Reverse complement sequence

TGGCCGTGCCTAGGCCGGGCTGTGTCGAGCGGGCCTTTTGGCCATCTATAGGTTCACCCTTGTTATTGTGGTCAAAATGTTGACTAGCTGAACAACCCTA[A/G,C]
CTTCCCAATTCATCTTTGCTCATATCGGTCGTCGGCGTCGGAAGAGCACGGCGCGGGCGTGCAGCACATTGGCGCACCGCACATCGATCGTATGTCGAGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.90% 13.90% 1.33% 0.00% G: 0.85%
All Indica  2759 98.90% 0.70% 0.36% 0.00% NA
All Japonica  1512 54.70% 41.50% 1.32% 0.00% G: 2.45%
Aus  269 87.00% 0.70% 12.27% 0.00% NA
Indica I  595 98.80% 1.00% 0.17% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.30% 0.10% 0.55% 0.00% NA
Indica Intermediate  786 98.00% 1.50% 0.51% 0.00% NA
Temperate Japonica  767 28.40% 64.40% 2.48% 0.00% G: 4.69%
Tropical Japonica  504 83.70% 16.10% 0.20% 0.00% NA
Japonica Intermediate  241 77.60% 22.00% 0.00% 0.00% G: 0.41%
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 90.00% 6.70% 0.00% 0.00% G: 3.33%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1124276697 T -> G LOC_Os11g40674.1 downstream_gene_variant ; 2442.0bp to feature; MODIFIER silent_mutation Average:81.838; most accessible tissue: Minghui63 panicle, score: 91.227 N N N N
vg1124276697 T -> G LOC_Os11g40680.1 downstream_gene_variant ; 1925.0bp to feature; MODIFIER silent_mutation Average:81.838; most accessible tissue: Minghui63 panicle, score: 91.227 N N N N
vg1124276697 T -> G LOC_Os11g40674-LOC_Os11g40680 intergenic_region ; MODIFIER silent_mutation Average:81.838; most accessible tissue: Minghui63 panicle, score: 91.227 N N N N
vg1124276697 T -> C LOC_Os11g40674.1 downstream_gene_variant ; 2442.0bp to feature; MODIFIER silent_mutation Average:81.838; most accessible tissue: Minghui63 panicle, score: 91.227 N N N N
vg1124276697 T -> C LOC_Os11g40680.1 downstream_gene_variant ; 1925.0bp to feature; MODIFIER silent_mutation Average:81.838; most accessible tissue: Minghui63 panicle, score: 91.227 N N N N
vg1124276697 T -> C LOC_Os11g40674-LOC_Os11g40680 intergenic_region ; MODIFIER silent_mutation Average:81.838; most accessible tissue: Minghui63 panicle, score: 91.227 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1124276697 T C 0.02 0.02 0.01 0.02 0.03 0.02
vg1124276697 T G 0.11 0.09 0.06 0.1 0.11 0.11

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1124276697 NA 5.66E-13 mr1013 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124276697 NA 4.01E-06 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124276697 NA 5.13E-14 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124276697 NA 4.17E-07 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124276697 NA 4.38E-14 mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124276697 NA 1.62E-06 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124276697 NA 1.59E-10 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124276697 NA 8.20E-21 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124276697 NA 3.83E-10 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124276697 2.21E-06 8.00E-19 mr1013_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124276697 NA 1.29E-07 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124276697 NA 2.57E-16 mr1031_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124276697 NA 7.09E-08 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124276697 NA 4.50E-06 mr1263_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124276697 NA 2.85E-31 mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124276697 NA 2.25E-08 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124276697 NA 6.70E-06 mr1577_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124276697 NA 1.17E-07 mr1599_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124276697 NA 2.31E-07 mr1693_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124276697 NA 1.96E-15 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124276697 NA 2.11E-07 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124276697 NA 3.12E-06 mr1966_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251