\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124252852:

Variant ID: vg1124252852 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 24252852
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.69, C: 0.31, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


GAGAATGAAGTCCTTACTCACAGAAAACTAAATCCAAAATTTATAATATAAGCTAGAAGTAGATTTGCTAGATAAATTTCTAGAGCGATGCAGCGGAGTC[T/C]
ATCCTATAGATTGTATCACCCTTGATGTTGGTGAAATGGCACACCTGCAGTGTTAATTCTATATTAGTAGGAAGCATAGATATATCATACAATAATTAAA

Reverse complement sequence

TTTAATTATTGTATGATATATCTATGCTTCCTACTAATATAGAATTAACACTGCAGGTGTGCCATTTCACCAACATCAAGGGTGATACAATCTATAGGAT[A/G]
GACTCCGCTGCATCGCTCTAGAAATTTATCTAGCAAATCTACTTCTAGCTTATATTATAAATTTTGGATTTAGTTTTCTGTGAGTAAGGACTTCATTCTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.20% 17.80% 6.62% 1.38% NA
All Indica  2759 97.60% 1.30% 1.01% 0.04% NA
All Japonica  1512 31.30% 52.10% 12.50% 4.17% NA
Aus  269 89.60% 0.70% 9.29% 0.37% NA
Indica I  595 99.00% 1.00% 0.00% 0.00% NA
Indica II  465 97.20% 1.90% 0.86% 0.00% NA
Indica III  913 98.50% 0.30% 1.20% 0.00% NA
Indica Intermediate  786 95.90% 2.30% 1.65% 0.13% NA
Temperate Japonica  767 17.20% 74.10% 6.91% 1.83% NA
Tropical Japonica  504 39.90% 29.20% 22.02% 8.93% NA
Japonica Intermediate  241 58.10% 29.90% 10.37% 1.66% NA
VI/Aromatic  96 37.50% 3.10% 59.38% 0.00% NA
Intermediate  90 70.00% 14.40% 15.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1124252852 T -> DEL N N silent_mutation Average:14.412; most accessible tissue: Zhenshan97 flag leaf, score: 19.61 N N N N
vg1124252852 T -> C LOC_Os11g40630.1 downstream_gene_variant ; 407.0bp to feature; MODIFIER silent_mutation Average:14.412; most accessible tissue: Zhenshan97 flag leaf, score: 19.61 N N N N
vg1124252852 T -> C LOC_Os11g40640.1 downstream_gene_variant ; 101.0bp to feature; MODIFIER silent_mutation Average:14.412; most accessible tissue: Zhenshan97 flag leaf, score: 19.61 N N N N
vg1124252852 T -> C LOC_Os11g40630-LOC_Os11g40640 intergenic_region ; MODIFIER silent_mutation Average:14.412; most accessible tissue: Zhenshan97 flag leaf, score: 19.61 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1124252852 NA 1.12E-11 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1124252852 NA 1.65E-20 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124252852 NA 7.75E-06 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124252852 NA 3.49E-06 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124252852 NA 2.99E-07 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124252852 NA 6.49E-07 mr1263_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124252852 3.25E-07 3.25E-07 mr1418_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124252852 NA 1.17E-06 mr1419_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124252852 NA 2.57E-07 mr1420_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124252852 NA 4.67E-07 mr1488_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124252852 NA 1.33E-06 mr1492_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124252852 1.83E-06 1.83E-06 mr1506_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124252852 NA 5.02E-06 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124252852 NA 6.63E-06 mr1556_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124252852 NA 3.47E-06 mr1693_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124252852 NA 7.94E-08 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124252852 NA 2.93E-06 mr1764_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124252852 NA 1.01E-06 mr1779_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124252852 NA 6.93E-06 mr1813_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124252852 NA 4.79E-07 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124252852 NA 2.02E-07 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124252852 8.04E-06 8.03E-06 mr1992_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251