Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124247036:

Variant ID: vg1124247036 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 24247036
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.74, G: 0.26, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:


TCTAGTACTCAATCTCATTGAGGCCAGACGATCACGTTCCGTACAAGCTATGTCTAGTACAGTTTATACACTTCCAGGAGAAATAATTGAGAAATAACTT[T/G]
TAAAGCGAAGATTTTTTGCTTGACTATGTCGCCAAAAAAGTGGTAGAACCCCAGCCACAAATAGAGGAGTAAAGACCCAAATGCCTCCTGATGCATTCCA

Reverse complement sequence

TGGAATGCATCAGGAGGCATTTGGGTCTTTACTCCTCTATTTGTGGCTGGGGTTCTACCACTTTTTTGGCGACATAGTCAAGCAAAAAATCTTCGCTTTA[A/C]
AAGTTATTTCTCAATTATTTCTCCTGGAAGTGTATAAACTGTACTAGACATAGCTTGTACGGAACGTGATCGTCTGGCCTCAATGAGATTGAGTACTAGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.80% 42.00% 0.19% 0.00% NA
All Indica  2759 42.50% 57.40% 0.14% 0.00% NA
All Japonica  1512 81.00% 18.80% 0.20% 0.00% NA
Aus  269 89.20% 10.80% 0.00% 0.00% NA
Indica I  595 19.70% 80.30% 0.00% 0.00% NA
Indica II  465 39.60% 60.20% 0.22% 0.00% NA
Indica III  913 60.70% 39.30% 0.00% 0.00% NA
Indica Intermediate  786 40.30% 59.30% 0.38% 0.00% NA
Temperate Japonica  767 84.00% 15.60% 0.39% 0.00% NA
Tropical Japonica  504 86.50% 13.50% 0.00% 0.00% NA
Japonica Intermediate  241 60.20% 39.80% 0.00% 0.00% NA
VI/Aromatic  96 44.80% 55.20% 0.00% 0.00% NA
Intermediate  90 55.60% 42.20% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1124247036 T -> G LOC_Os11g40630.1 upstream_gene_variant ; 3355.0bp to feature; MODIFIER silent_mutation Average:70.714; most accessible tissue: Zhenshan97 young leaf, score: 92.708 N N N N
vg1124247036 T -> G LOC_Os11g40620.1 downstream_gene_variant ; 368.0bp to feature; MODIFIER silent_mutation Average:70.714; most accessible tissue: Zhenshan97 young leaf, score: 92.708 N N N N
vg1124247036 T -> G LOC_Os11g40610-LOC_Os11g40620 intergenic_region ; MODIFIER silent_mutation Average:70.714; most accessible tissue: Zhenshan97 young leaf, score: 92.708 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1124247036 T G 0.0 0.0 0.0 -0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1124247036 8.36E-06 8.36E-06 mr1418_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124247036 NA 9.92E-06 mr1419_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124247036 3.73E-06 3.72E-06 mr1466_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124247036 NA 3.02E-06 mr1488_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124247036 NA 1.77E-06 mr1492_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124247036 NA 3.82E-06 mr1556_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124247036 NA 6.26E-06 mr1689_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124247036 NA 1.80E-06 mr1764_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124247036 NA 7.81E-07 mr1779_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124247036 NA 1.04E-06 mr1813_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124247036 5.26E-07 5.26E-07 mr1824_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124247036 5.13E-06 5.12E-06 mr1831_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124247036 6.21E-06 6.21E-06 mr1840_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124247036 NA 9.55E-07 mr1894_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251