RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg1124221076:

Variant ID: vg1124221076 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 24221076
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTATTTTGAATGAAAGAATTAATCTGAAGAAGTATCAAGGAGGGCAGAAAATCACCTAATTTGAAGACGGATAAGTTCAGTATTGCAATCATACACAAAG[T/C]
GAGTCCAGCAGCTCATCTTTTGATCCTTGATGGAATTCGGTGACAGAAAACTCTTAAGAGAGAAAGGTTCTGTCCTGATCATGCTAAGAACCTGCTGAGC

Reverse complement sequence

GCTCAGCAGGTTCTTAGCATGATCAGGACAGAACCTTTCTCTCTTAAGAGTTTTCTGTCACCGAATTCCATCAAGGATCAAAAGATGAGCTGCTGGACTC[A/G]
CTTTGTGTATGATTGCAATACTGAACTTATCCGTCTTCAAATTAGGTGATTTTCTGCCCTCCTTGATACTTCTTCAGATTAATTCTTTCATTCAAAATAA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.30%	11.60%	0.02%	0.00%	NA
All Indica	2759	99.50%	0.50%	0.04%	0.00%	NA
All Japonica	1512	65.30%	34.70%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	99.50%	0.50%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	98.70%	1.10%	0.13%	0.00%	NA
Temperate Japonica	767	36.10%	63.90%	0.00%	0.00%	NA
Tropical Japonica	504	99.00%	1.00%	0.00%	0.00%	NA
Japonica Intermediate	241	88.00%	12.00%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	88.90%	11.10%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1124221076	T -> C	LOC_Os11g40590.1	missense_variant ; p.His491Arg; MODERATE	nonsynonymous_codon ; H491R	Average:50.5; most accessible tissue: Zhenshan97 flower, score: 73.141	possibly damaging	-1.872	TOLERATED	1.00
vg1124221076	T -> C	LOC_Os11g40590.2	missense_variant ; p.His491Arg; MODERATE	nonsynonymous_codon ; H491R	Average:50.5; most accessible tissue: Zhenshan97 flower, score: 73.141	possibly damaging	-1.872	TOLERATED	1.00
vg1124221076	T -> C	LOC_Os11g40590.3	missense_variant ; p.His491Arg; MODERATE	nonsynonymous_codon ; H491R	Average:50.5; most accessible tissue: Zhenshan97 flower, score: 73.141	possibly damaging	-1.872	TOLERATED	1.00

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1124221076	NA	3.78E-07	mr1300	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124221076	1.05E-06	NA	mr1310	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124221076	NA	1.12E-10	mr1310	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124221076	NA	5.14E-06	mr1900	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124221076	9.75E-06	NA	mr1926	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124221076	NA	7.02E-10	mr1926	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124221076	NA	3.30E-12	mr1959	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124221076	5.73E-06	4.66E-08	mr1959	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124221076	NA	4.81E-10	mr1310_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124221076	8.63E-06	8.63E-06	mr1609_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 13 entries

Previous1 2Next

Search for Variation information by Variation ID:

Detailed information for vg1124221076:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact