\
| Variant ID: vg1124217261 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 24217261 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 94. )
AGTAATAGGTATCATTATACTCTACATTGTCAATTTTTTTTCATAATTTTTCACAACTATTTGCATTGAATTTAGAAGAAAAAGATATACGAGGGGATAT[C/T]
CCCTCGAGGGATTAGAATCGACTCCCTAGTAGTAGATGATAGAATGATCCCCCTACATCATGAAAGGTGCTACTACATCCAATTAAAAAAAAGTGGACTT
AAGTCCACTTTTTTTTAATTGGATGTAGTAGCACCTTTCATGATGTAGGGGGATCATTCTATCATCTACTACTAGGGAGTCGATTCTAATCCCTCGAGGG[G/A]
ATATCCCCTCGTATATCTTTTTCTTCTAAATTCAATGCAAATAGTTGTGAAAAATTATGAAAAAAAATTGACAATGTAGAGTATAATGATACCTATTACT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.30% | 1.80% | 2.90% | 56.94% | NA |
| All Indica | 2759 | 18.00% | 0.30% | 3.12% | 78.54% | NA |
| All Japonica | 1512 | 64.40% | 4.80% | 1.85% | 28.97% | NA |
| Aus | 269 | 83.30% | 0.00% | 6.69% | 10.04% | NA |
| Indica I | 595 | 12.40% | 0.00% | 2.52% | 85.04% | NA |
| Indica II | 465 | 8.60% | 1.70% | 1.94% | 87.74% | NA |
| Indica III | 913 | 25.10% | 0.00% | 3.72% | 71.19% | NA |
| Indica Intermediate | 786 | 19.60% | 0.10% | 3.56% | 76.72% | NA |
| Temperate Japonica | 767 | 81.00% | 0.50% | 2.09% | 16.43% | NA |
| Tropical Japonica | 504 | 48.40% | 11.50% | 1.19% | 38.89% | NA |
| Japonica Intermediate | 241 | 45.20% | 4.10% | 2.49% | 48.13% | NA |
| VI/Aromatic | 96 | 83.30% | 0.00% | 1.04% | 15.62% | NA |
| Intermediate | 90 | 41.10% | 5.60% | 4.44% | 48.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1124217261 | C -> T | LOC_Os11g40570.1 | upstream_gene_variant ; 2668.0bp to feature; MODIFIER | silent_mutation | Average:65.51; most accessible tissue: Zhenshan97 root, score: 86.14 | N | N | N | N |
| vg1124217261 | C -> T | LOC_Os11g40570.3 | upstream_gene_variant ; 2947.0bp to feature; MODIFIER | silent_mutation | Average:65.51; most accessible tissue: Zhenshan97 root, score: 86.14 | N | N | N | N |
| vg1124217261 | C -> T | LOC_Os11g40570.2 | upstream_gene_variant ; 2668.0bp to feature; MODIFIER | silent_mutation | Average:65.51; most accessible tissue: Zhenshan97 root, score: 86.14 | N | N | N | N |
| vg1124217261 | C -> T | LOC_Os11g40590.1 | downstream_gene_variant ; 164.0bp to feature; MODIFIER | silent_mutation | Average:65.51; most accessible tissue: Zhenshan97 root, score: 86.14 | N | N | N | N |
| vg1124217261 | C -> T | LOC_Os11g40590.2 | downstream_gene_variant ; 1519.0bp to feature; MODIFIER | silent_mutation | Average:65.51; most accessible tissue: Zhenshan97 root, score: 86.14 | N | N | N | N |
| vg1124217261 | C -> T | LOC_Os11g40590.3 | downstream_gene_variant ; 1519.0bp to feature; MODIFIER | silent_mutation | Average:65.51; most accessible tissue: Zhenshan97 root, score: 86.14 | N | N | N | N |
| vg1124217261 | C -> T | LOC_Os11g40570-LOC_Os11g40590 | intergenic_region ; MODIFIER | silent_mutation | Average:65.51; most accessible tissue: Zhenshan97 root, score: 86.14 | N | N | N | N |
| vg1124217261 | C -> DEL | N | N | silent_mutation | Average:65.51; most accessible tissue: Zhenshan97 root, score: 86.14 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1124217261 | NA | 5.76E-07 | mr1125 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124217261 | 1.27E-06 | 6.82E-10 | mr1188 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124217261 | NA | 9.11E-07 | mr1448 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124217261 | NA | 1.68E-09 | mr1188_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124217261 | NA | 6.21E-08 | mr1218_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124217261 | NA | 3.97E-07 | mr1422_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124217261 | NA | 1.41E-06 | mr1583_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124217261 | NA | 1.87E-10 | mr1850_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124217261 | NA | 5.73E-06 | mr1974_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |