\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124217261:

Variant ID: vg1124217261 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 24217261
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


AGTAATAGGTATCATTATACTCTACATTGTCAATTTTTTTTCATAATTTTTCACAACTATTTGCATTGAATTTAGAAGAAAAAGATATACGAGGGGATAT[C/T]
CCCTCGAGGGATTAGAATCGACTCCCTAGTAGTAGATGATAGAATGATCCCCCTACATCATGAAAGGTGCTACTACATCCAATTAAAAAAAAGTGGACTT

Reverse complement sequence

AAGTCCACTTTTTTTTAATTGGATGTAGTAGCACCTTTCATGATGTAGGGGGATCATTCTATCATCTACTACTAGGGAGTCGATTCTAATCCCTCGAGGG[G/A]
ATATCCCCTCGTATATCTTTTTCTTCTAAATTCAATGCAAATAGTTGTGAAAAATTATGAAAAAAAATTGACAATGTAGAGTATAATGATACCTATTACT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.30% 1.80% 2.90% 56.94% NA
All Indica  2759 18.00% 0.30% 3.12% 78.54% NA
All Japonica  1512 64.40% 4.80% 1.85% 28.97% NA
Aus  269 83.30% 0.00% 6.69% 10.04% NA
Indica I  595 12.40% 0.00% 2.52% 85.04% NA
Indica II  465 8.60% 1.70% 1.94% 87.74% NA
Indica III  913 25.10% 0.00% 3.72% 71.19% NA
Indica Intermediate  786 19.60% 0.10% 3.56% 76.72% NA
Temperate Japonica  767 81.00% 0.50% 2.09% 16.43% NA
Tropical Japonica  504 48.40% 11.50% 1.19% 38.89% NA
Japonica Intermediate  241 45.20% 4.10% 2.49% 48.13% NA
VI/Aromatic  96 83.30% 0.00% 1.04% 15.62% NA
Intermediate  90 41.10% 5.60% 4.44% 48.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1124217261 C -> T LOC_Os11g40570.1 upstream_gene_variant ; 2668.0bp to feature; MODIFIER silent_mutation Average:65.51; most accessible tissue: Zhenshan97 root, score: 86.14 N N N N
vg1124217261 C -> T LOC_Os11g40570.3 upstream_gene_variant ; 2947.0bp to feature; MODIFIER silent_mutation Average:65.51; most accessible tissue: Zhenshan97 root, score: 86.14 N N N N
vg1124217261 C -> T LOC_Os11g40570.2 upstream_gene_variant ; 2668.0bp to feature; MODIFIER silent_mutation Average:65.51; most accessible tissue: Zhenshan97 root, score: 86.14 N N N N
vg1124217261 C -> T LOC_Os11g40590.1 downstream_gene_variant ; 164.0bp to feature; MODIFIER silent_mutation Average:65.51; most accessible tissue: Zhenshan97 root, score: 86.14 N N N N
vg1124217261 C -> T LOC_Os11g40590.2 downstream_gene_variant ; 1519.0bp to feature; MODIFIER silent_mutation Average:65.51; most accessible tissue: Zhenshan97 root, score: 86.14 N N N N
vg1124217261 C -> T LOC_Os11g40590.3 downstream_gene_variant ; 1519.0bp to feature; MODIFIER silent_mutation Average:65.51; most accessible tissue: Zhenshan97 root, score: 86.14 N N N N
vg1124217261 C -> T LOC_Os11g40570-LOC_Os11g40590 intergenic_region ; MODIFIER silent_mutation Average:65.51; most accessible tissue: Zhenshan97 root, score: 86.14 N N N N
vg1124217261 C -> DEL N N silent_mutation Average:65.51; most accessible tissue: Zhenshan97 root, score: 86.14 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1124217261 NA 5.76E-07 mr1125 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124217261 1.27E-06 6.82E-10 mr1188 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124217261 NA 9.11E-07 mr1448 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124217261 NA 1.68E-09 mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124217261 NA 6.21E-08 mr1218_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124217261 NA 3.97E-07 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124217261 NA 1.41E-06 mr1583_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124217261 NA 1.87E-10 mr1850_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124217261 NA 5.73E-06 mr1974_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251