\
| Variant ID: vg1124199328 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 24199328 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.57, T: 0.43, others allele: 0.00, population size: 90. )
TGACAAACATGGGCAACACTTGTGATTGGTGGGGCCATAAAATAAAGAAAAACAACAACTTATGATAAATTATCAACTTGTACATATATGCCTTTAAAAT[G/T]
GGTAGAATCAGCTGAAAGTAGGTATATATAGCTAGTTATAATTTGATTTAGATTTTGCATATGTATTTAATGCATTGTAATACAATTTCTCATTCACAAT
ATTGTGAATGAGAAATTGTATTACAATGCATTAAATACATATGCAAAATCTAAATCAAATTATAACTAGCTATATATACCTACTTTCAGCTGATTCTACC[C/A]
ATTTTAAAGGCATATATGTACAAGTTGATAATTTATCATAAGTTGTTGTTTTTCTTTATTTTATGGCCCCACCAATCACAAGTGTTGCCCATGTTTGTCA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 25.20% | 21.10% | 0.44% | 53.30% | NA |
| All Indica | 2759 | 17.50% | 2.30% | 0.65% | 79.56% | NA |
| All Japonica | 1512 | 25.50% | 58.70% | 0.20% | 15.67% | NA |
| Aus | 269 | 81.40% | 2.60% | 0.00% | 15.99% | NA |
| Indica I | 595 | 10.10% | 1.30% | 0.67% | 87.90% | NA |
| Indica II | 465 | 5.60% | 3.20% | 0.86% | 90.32% | NA |
| Indica III | 913 | 28.70% | 2.20% | 0.44% | 68.67% | NA |
| Indica Intermediate | 786 | 17.20% | 2.50% | 0.76% | 79.52% | NA |
| Temperate Japonica | 767 | 19.90% | 68.30% | 0.13% | 11.60% | NA |
| Tropical Japonica | 504 | 34.10% | 55.20% | 0.20% | 10.52% | NA |
| Japonica Intermediate | 241 | 24.90% | 35.30% | 0.41% | 39.42% | NA |
| VI/Aromatic | 96 | 71.90% | 18.80% | 0.00% | 9.38% | NA |
| Intermediate | 90 | 38.90% | 22.20% | 0.00% | 38.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1124199328 | G -> T | LOC_Os11g40560.1 | upstream_gene_variant ; 4296.0bp to feature; MODIFIER | silent_mutation | Average:8.206; most accessible tissue: Callus, score: 40.732 | N | N | N | N |
| vg1124199328 | G -> T | LOC_Os11g40550.1 | downstream_gene_variant ; 4056.0bp to feature; MODIFIER | silent_mutation | Average:8.206; most accessible tissue: Callus, score: 40.732 | N | N | N | N |
| vg1124199328 | G -> T | LOC_Os11g40550.2 | downstream_gene_variant ; 4033.0bp to feature; MODIFIER | silent_mutation | Average:8.206; most accessible tissue: Callus, score: 40.732 | N | N | N | N |
| vg1124199328 | G -> T | LOC_Os11g40550-LOC_Os11g40560 | intergenic_region ; MODIFIER | silent_mutation | Average:8.206; most accessible tissue: Callus, score: 40.732 | N | N | N | N |
| vg1124199328 | G -> DEL | N | N | silent_mutation | Average:8.206; most accessible tissue: Callus, score: 40.732 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1124199328 | 5.56E-06 | NA | mr1238_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124199328 | 5.14E-07 | 6.26E-08 | mr1693_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124199328 | NA | 5.17E-07 | mr1693_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124199328 | NA | 1.75E-07 | mr1837_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124199328 | NA | 2.16E-06 | mr1840_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124199328 | NA | 1.84E-08 | mr1905_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |