Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1124199328:

Variant ID: vg1124199328 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 24199328
Reference Allele: G	Alternative Allele: T
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.57, T: 0.43, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:

TGACAAACATGGGCAACACTTGTGATTGGTGGGGCCATAAAATAAAGAAAAACAACAACTTATGATAAATTATCAACTTGTACATATATGCCTTTAAAAT[G/T]
GGTAGAATCAGCTGAAAGTAGGTATATATAGCTAGTTATAATTTGATTTAGATTTTGCATATGTATTTAATGCATTGTAATACAATTTCTCATTCACAAT

Reverse complement sequence

ATTGTGAATGAGAAATTGTATTACAATGCATTAAATACATATGCAAAATCTAAATCAAATTATAACTAGCTATATATACCTACTTTCAGCTGATTCTACC[C/A]
ATTTTAAAGGCATATATGTACAAGTTGATAATTTATCATAAGTTGTTGTTTTTCTTTATTTTATGGCCCCACCAATCACAAGTGTTGCCCATGTTTGTCA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	25.20%	21.10%	0.44%	53.30%	NA
All Indica	2759	17.50%	2.30%	0.65%	79.56%	NA
All Japonica	1512	25.50%	58.70%	0.20%	15.67%	NA
Aus	269	81.40%	2.60%	0.00%	15.99%	NA
Indica I	595	10.10%	1.30%	0.67%	87.90%	NA
Indica II	465	5.60%	3.20%	0.86%	90.32%	NA
Indica III	913	28.70%	2.20%	0.44%	68.67%	NA
Indica Intermediate	786	17.20%	2.50%	0.76%	79.52%	NA
Temperate Japonica	767	19.90%	68.30%	0.13%	11.60%	NA
Tropical Japonica	504	34.10%	55.20%	0.20%	10.52%	NA
Japonica Intermediate	241	24.90%	35.30%	0.41%	39.42%	NA
VI/Aromatic	96	71.90%	18.80%	0.00%	9.38%	NA
Intermediate	90	38.90%	22.20%	0.00%	38.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1124199328	G -> T	LOC_Os11g40560.1	upstream_gene_variant ; 4296.0bp to feature; MODIFIER	silent_mutation	Average:8.206; most accessible tissue: Callus, score: 40.732	N	N	N	N
vg1124199328	G -> T	LOC_Os11g40550.1	downstream_gene_variant ; 4056.0bp to feature; MODIFIER	silent_mutation	Average:8.206; most accessible tissue: Callus, score: 40.732	N	N	N	N
vg1124199328	G -> T	LOC_Os11g40550.2	downstream_gene_variant ; 4033.0bp to feature; MODIFIER	silent_mutation	Average:8.206; most accessible tissue: Callus, score: 40.732	N	N	N	N
vg1124199328	G -> T	LOC_Os11g40550-LOC_Os11g40560	intergenic_region ; MODIFIER	silent_mutation	Average:8.206; most accessible tissue: Callus, score: 40.732	N	N	N	N
vg1124199328	G -> DEL	N	N	silent_mutation	Average:8.206; most accessible tissue: Callus, score: 40.732	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1124199328	5.56E-06	NA	mr1238_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124199328	5.14E-07	6.26E-08	mr1693_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124199328	NA	5.17E-07	mr1693_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124199328	NA	1.75E-07	mr1837_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124199328	NA	2.16E-06	mr1840_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124199328	NA	1.84E-08	mr1905_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251