\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124199328:

Variant ID: vg1124199328 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 24199328
Reference Allele: GAlternative Allele: T
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.57, T: 0.43, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


TGACAAACATGGGCAACACTTGTGATTGGTGGGGCCATAAAATAAAGAAAAACAACAACTTATGATAAATTATCAACTTGTACATATATGCCTTTAAAAT[G/T]
GGTAGAATCAGCTGAAAGTAGGTATATATAGCTAGTTATAATTTGATTTAGATTTTGCATATGTATTTAATGCATTGTAATACAATTTCTCATTCACAAT

Reverse complement sequence

ATTGTGAATGAGAAATTGTATTACAATGCATTAAATACATATGCAAAATCTAAATCAAATTATAACTAGCTATATATACCTACTTTCAGCTGATTCTACC[C/A]
ATTTTAAAGGCATATATGTACAAGTTGATAATTTATCATAAGTTGTTGTTTTTCTTTATTTTATGGCCCCACCAATCACAAGTGTTGCCCATGTTTGTCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 25.20% 21.10% 0.44% 53.30% NA
All Indica  2759 17.50% 2.30% 0.65% 79.56% NA
All Japonica  1512 25.50% 58.70% 0.20% 15.67% NA
Aus  269 81.40% 2.60% 0.00% 15.99% NA
Indica I  595 10.10% 1.30% 0.67% 87.90% NA
Indica II  465 5.60% 3.20% 0.86% 90.32% NA
Indica III  913 28.70% 2.20% 0.44% 68.67% NA
Indica Intermediate  786 17.20% 2.50% 0.76% 79.52% NA
Temperate Japonica  767 19.90% 68.30% 0.13% 11.60% NA
Tropical Japonica  504 34.10% 55.20% 0.20% 10.52% NA
Japonica Intermediate  241 24.90% 35.30% 0.41% 39.42% NA
VI/Aromatic  96 71.90% 18.80% 0.00% 9.38% NA
Intermediate  90 38.90% 22.20% 0.00% 38.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1124199328 G -> T LOC_Os11g40560.1 upstream_gene_variant ; 4296.0bp to feature; MODIFIER silent_mutation Average:8.206; most accessible tissue: Callus, score: 40.732 N N N N
vg1124199328 G -> T LOC_Os11g40550.1 downstream_gene_variant ; 4056.0bp to feature; MODIFIER silent_mutation Average:8.206; most accessible tissue: Callus, score: 40.732 N N N N
vg1124199328 G -> T LOC_Os11g40550.2 downstream_gene_variant ; 4033.0bp to feature; MODIFIER silent_mutation Average:8.206; most accessible tissue: Callus, score: 40.732 N N N N
vg1124199328 G -> T LOC_Os11g40550-LOC_Os11g40560 intergenic_region ; MODIFIER silent_mutation Average:8.206; most accessible tissue: Callus, score: 40.732 N N N N
vg1124199328 G -> DEL N N silent_mutation Average:8.206; most accessible tissue: Callus, score: 40.732 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1124199328 5.56E-06 NA mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124199328 5.14E-07 6.26E-08 mr1693_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124199328 NA 5.17E-07 mr1693_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124199328 NA 1.75E-07 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124199328 NA 2.16E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124199328 NA 1.84E-08 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251