\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124179099:

Variant ID: vg1124179099 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 24179099
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, C: 0.06, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


CGTAGGCGGCGTGCCTGTGCGCGTACGCGCGGAGCCCCAACTACGGCAGATACATCTGAAGCCCCAAGACCAGGTGCCTCTTTGTTGTCTGTGGTCTCCC[T/C]
GTGCCGTGCTGCCCCTAGACCTCAATTAGCTTGCATCGGTCATGCCCATGGCCATGGCTTTGGAACTCTAGCTAGATCATGGATGGATGCACAGTTTAAA

Reverse complement sequence

TTTAAACTGTGCATCCATCCATGATCTAGCTAGAGTTCCAAAGCCATGGCCATGGGCATGACCGATGCAAGCTAATTGAGGTCTAGGGGCAGCACGGCAC[A/G]
GGGAGACCACAGACAACAAAGAGGCACCTGGTCTTGGGGCTTCAGATGTATCTGCCGTAGTTGGGGCTCCGCGCGTACGCGCACAGGCACGCCGCCTACG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.20% 34.80% 0.00% 0.00% NA
All Indica  2759 83.90% 16.10% 0.00% 0.00% NA
All Japonica  1512 41.20% 58.80% 0.00% 0.00% NA
Aus  269 27.10% 72.90% 0.00% 0.00% NA
Indica I  595 89.60% 10.40% 0.00% 0.00% NA
Indica II  465 94.60% 5.40% 0.00% 0.00% NA
Indica III  913 74.20% 25.80% 0.00% 0.00% NA
Indica Intermediate  786 84.50% 15.50% 0.00% 0.00% NA
Temperate Japonica  767 32.50% 67.50% 0.00% 0.00% NA
Tropical Japonica  504 44.60% 55.40% 0.00% 0.00% NA
Japonica Intermediate  241 61.80% 38.20% 0.00% 0.00% NA
VI/Aromatic  96 16.70% 83.30% 0.00% 0.00% NA
Intermediate  90 58.90% 41.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1124179099 T -> C LOC_Os11g40510.1 upstream_gene_variant ; 3478.0bp to feature; MODIFIER silent_mutation Average:78.765; most accessible tissue: Minghui63 panicle, score: 91.034 N N N N
vg1124179099 T -> C LOC_Os11g40530.1 upstream_gene_variant ; 1806.0bp to feature; MODIFIER silent_mutation Average:78.765; most accessible tissue: Minghui63 panicle, score: 91.034 N N N N
vg1124179099 T -> C LOC_Os11g40510.2 upstream_gene_variant ; 3478.0bp to feature; MODIFIER silent_mutation Average:78.765; most accessible tissue: Minghui63 panicle, score: 91.034 N N N N
vg1124179099 T -> C LOC_Os11g40520.1 intron_variant ; MODIFIER silent_mutation Average:78.765; most accessible tissue: Minghui63 panicle, score: 91.034 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1124179099 T C 0.0 -0.01 0.01 0.04 0.04 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1124179099 9.25E-06 9.25E-06 mr1418_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124179099 NA 8.66E-06 mr1419_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124179099 8.23E-06 8.23E-06 mr1466_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124179099 NA 3.93E-08 mr1693_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124179099 NA 1.81E-06 mr1745_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124179099 3.66E-06 3.66E-06 mr1747_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124179099 NA 7.13E-06 mr1759_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251