Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124179089:

Variant ID: vg1124179089 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 24179089
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAGCTGAGGGCGTAGGCGGCGTGCCTGTGCGCGTACGCGCGGAGCCCCAACTACGGCAGATACATCTGAAGCCCCAAGACCAGGTGCCTCTTTGTTGTCT[G/A]
TGGTCTCCCTGTGCCGTGCTGCCCCTAGACCTCAATTAGCTTGCATCGGTCATGCCCATGGCCATGGCTTTGGAACTCTAGCTAGATCATGGATGGATGC

Reverse complement sequence

GCATCCATCCATGATCTAGCTAGAGTTCCAAAGCCATGGCCATGGGCATGACCGATGCAAGCTAATTGAGGTCTAGGGGCAGCACGGCACAGGGAGACCA[C/T]
AGACAACAAAGAGGCACCTGGTCTTGGGGCTTCAGATGTATCTGCCGTAGTTGGGGCTCCGCGCGTACGCGCACAGGCACGCCGCCTACGCCCTCAGCTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.20% 7.70% 0.02% 0.00% NA
All Indica  2759 95.00% 4.90% 0.04% 0.00% NA
All Japonica  1512 86.80% 13.20% 0.00% 0.00% NA
Aus  269 91.40% 8.60% 0.00% 0.00% NA
Indica I  595 94.10% 5.90% 0.00% 0.00% NA
Indica II  465 97.40% 2.40% 0.22% 0.00% NA
Indica III  913 91.70% 8.30% 0.00% 0.00% NA
Indica Intermediate  786 98.20% 1.80% 0.00% 0.00% NA
Temperate Japonica  767 94.90% 5.10% 0.00% 0.00% NA
Tropical Japonica  504 75.60% 24.40% 0.00% 0.00% NA
Japonica Intermediate  241 84.20% 15.80% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 93.30% 6.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1124179089 G -> A LOC_Os11g40510.1 upstream_gene_variant ; 3468.0bp to feature; MODIFIER silent_mutation Average:78.842; most accessible tissue: Zhenshan97 panicle, score: 91.03 N N N N
vg1124179089 G -> A LOC_Os11g40530.1 upstream_gene_variant ; 1816.0bp to feature; MODIFIER silent_mutation Average:78.842; most accessible tissue: Zhenshan97 panicle, score: 91.03 N N N N
vg1124179089 G -> A LOC_Os11g40510.2 upstream_gene_variant ; 3468.0bp to feature; MODIFIER silent_mutation Average:78.842; most accessible tissue: Zhenshan97 panicle, score: 91.03 N N N N
vg1124179089 G -> A LOC_Os11g40520.1 intron_variant ; MODIFIER silent_mutation Average:78.842; most accessible tissue: Zhenshan97 panicle, score: 91.03 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1124179089 G A -0.03 -0.03 -0.03 -0.03 -0.05 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1124179089 NA 7.45E-06 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124179089 NA 8.70E-06 mr1284_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124179089 NA 3.62E-06 mr1374_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124179089 NA 6.25E-06 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124179089 5.93E-06 5.92E-06 mr1766_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124179089 NA 7.70E-06 mr1812_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124179089 NA 2.41E-06 mr1816_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124179089 NA 4.31E-06 mr1832_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124179089 NA 2.28E-06 mr1833_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124179089 2.58E-07 2.57E-07 mr1979_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251