\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124163322:

Variant ID: vg1124163322 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 24163322
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.61, C: 0.39, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


CAACATGGGAACACGCCGCCGCCGACTCGTCCACATAGATGGACACCTCGCGTCCTCTGACAGATTAATCTGTAAGACGCTTCTTCGACGACATCGACCG[T/C]
GTCCTCTATGACGGCAACGACCGCATCACCGACGATGACATCGATCACGTCATCTACGACGACCAACCAAAGTGGTGGCCTCATTGCCAACGACGTCCCC

Reverse complement sequence

GGGGACGTCGTTGGCAATGAGGCCACCACTTTGGTTGGTCGTCGTAGATGACGTGATCGATGTCATCGTCGGTGATGCGGTCGTTGCCGTCATAGAGGAC[A/G]
CGGTCGATGTCGTCGAAGAAGCGTCTTACAGATTAATCTGTCAGAGGACGCGAGGTGTCCATCTATGTGGACGAGTCGGCGGCGGCGTGTTCCCATGTTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.90% 24.10% 0.04% 0.00% NA
All Indica  2759 98.50% 1.50% 0.00% 0.00% NA
All Japonica  1512 30.20% 69.70% 0.13% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 98.80% 1.20% 0.00% 0.00% NA
Indica II  465 97.60% 2.40% 0.00% 0.00% NA
Indica III  913 99.10% 0.90% 0.00% 0.00% NA
Indica Intermediate  786 98.10% 1.90% 0.00% 0.00% NA
Temperate Japonica  767 14.10% 85.90% 0.00% 0.00% NA
Tropical Japonica  504 45.60% 54.00% 0.40% 0.00% NA
Japonica Intermediate  241 49.00% 51.00% 0.00% 0.00% NA
VI/Aromatic  96 82.30% 17.70% 0.00% 0.00% NA
Intermediate  90 73.30% 26.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1124163322 T -> C LOC_Os11g40480.1 downstream_gene_variant ; 1363.0bp to feature; MODIFIER silent_mutation Average:62.695; most accessible tissue: Zhenshan97 panicle, score: 76.605 N N N N
vg1124163322 T -> C LOC_Os11g40500.1 downstream_gene_variant ; 3108.0bp to feature; MODIFIER silent_mutation Average:62.695; most accessible tissue: Zhenshan97 panicle, score: 76.605 N N N N
vg1124163322 T -> C LOC_Os11g40500.2 downstream_gene_variant ; 3105.0bp to feature; MODIFIER silent_mutation Average:62.695; most accessible tissue: Zhenshan97 panicle, score: 76.605 N N N N
vg1124163322 T -> C LOC_Os11g40500.3 downstream_gene_variant ; 3108.0bp to feature; MODIFIER silent_mutation Average:62.695; most accessible tissue: Zhenshan97 panicle, score: 76.605 N N N N
vg1124163322 T -> C LOC_Os11g40490.1 intron_variant ; MODIFIER silent_mutation Average:62.695; most accessible tissue: Zhenshan97 panicle, score: 76.605 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1124163322 5.04E-06 NA mr1082 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124163322 NA 5.73E-07 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124163322 2.84E-06 2.84E-06 mr1609 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124163322 NA 5.90E-06 mr1788 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124163322 NA 7.47E-22 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124163322 NA 7.48E-07 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124163322 2.12E-06 NA mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124163322 NA 1.76E-06 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251