\
| Variant ID: vg1124163322 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 24163322 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.61, C: 0.39, others allele: 0.00, population size: 109. )
CAACATGGGAACACGCCGCCGCCGACTCGTCCACATAGATGGACACCTCGCGTCCTCTGACAGATTAATCTGTAAGACGCTTCTTCGACGACATCGACCG[T/C]
GTCCTCTATGACGGCAACGACCGCATCACCGACGATGACATCGATCACGTCATCTACGACGACCAACCAAAGTGGTGGCCTCATTGCCAACGACGTCCCC
GGGGACGTCGTTGGCAATGAGGCCACCACTTTGGTTGGTCGTCGTAGATGACGTGATCGATGTCATCGTCGGTGATGCGGTCGTTGCCGTCATAGAGGAC[A/G]
CGGTCGATGTCGTCGAAGAAGCGTCTTACAGATTAATCTGTCAGAGGACGCGAGGTGTCCATCTATGTGGACGAGTCGGCGGCGGCGTGTTCCCATGTTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.90% | 24.10% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 30.20% | 69.70% | 0.13% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 14.10% | 85.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 45.60% | 54.00% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 49.00% | 51.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 82.30% | 17.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 73.30% | 26.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1124163322 | T -> C | LOC_Os11g40480.1 | downstream_gene_variant ; 1363.0bp to feature; MODIFIER | silent_mutation | Average:62.695; most accessible tissue: Zhenshan97 panicle, score: 76.605 | N | N | N | N |
| vg1124163322 | T -> C | LOC_Os11g40500.1 | downstream_gene_variant ; 3108.0bp to feature; MODIFIER | silent_mutation | Average:62.695; most accessible tissue: Zhenshan97 panicle, score: 76.605 | N | N | N | N |
| vg1124163322 | T -> C | LOC_Os11g40500.2 | downstream_gene_variant ; 3105.0bp to feature; MODIFIER | silent_mutation | Average:62.695; most accessible tissue: Zhenshan97 panicle, score: 76.605 | N | N | N | N |
| vg1124163322 | T -> C | LOC_Os11g40500.3 | downstream_gene_variant ; 3108.0bp to feature; MODIFIER | silent_mutation | Average:62.695; most accessible tissue: Zhenshan97 panicle, score: 76.605 | N | N | N | N |
| vg1124163322 | T -> C | LOC_Os11g40490.1 | intron_variant ; MODIFIER | silent_mutation | Average:62.695; most accessible tissue: Zhenshan97 panicle, score: 76.605 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1124163322 | 5.04E-06 | NA | mr1082 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124163322 | NA | 5.73E-07 | mr1280 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124163322 | 2.84E-06 | 2.84E-06 | mr1609 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124163322 | NA | 5.90E-06 | mr1788 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124163322 | NA | 7.47E-22 | mr1010_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124163322 | NA | 7.48E-07 | mr1183_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124163322 | 2.12E-06 | NA | mr1226_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124163322 | NA | 1.76E-06 | mr1227_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |