Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124114500:

Variant ID: vg1124114500 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 24114500
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACAAGCACAATTAAAATGTAAAACCTGTTATTTCTGATATATGGAAATGGGGAAGCTCTGCTTTCCTAGTTAAAAAAAAAGAACACAATTAAAATATACC[T/A]
TTTTTTTTTGTAAAAGTGAAATTGTAAATTCATTTGAGGTAAATGTCCATGCACATTCCTTTTCTTGTTTATTGTGTTTGCATATCTGGACAAGTCGAGT

Reverse complement sequence

ACTCGACTTGTCCAGATATGCAAACACAATAAACAAGAAAAGGAATGTGCATGGACATTTACCTCAAATGAATTTACAATTTCACTTTTACAAAAAAAAA[A/T]
GGTATATTTTAATTGTGTTCTTTTTTTTTAACTAGGAAAGCAGAGCTTCCCCATTTCCATATATCAGAAATAACAGGTTTTACATTTTAATTGTGCTTGT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.30%	16.40%	0.32%	0.00%	NA
All Indica	2759	91.10%	8.50%	0.40%	0.00%	NA
All Japonica	1512	69.80%	29.90%	0.26%	0.00%	NA
Aus	269	92.60%	7.40%	0.00%	0.00%	NA
Indica I	595	97.50%	1.50%	1.01%	0.00%	NA
Indica II	465	91.40%	8.00%	0.65%	0.00%	NA
Indica III	913	84.40%	15.40%	0.11%	0.00%	NA
Indica Intermediate	786	93.80%	6.10%	0.13%	0.00%	NA
Temperate Japonica	767	84.70%	15.10%	0.13%	0.00%	NA
Tropical Japonica	504	52.00%	48.00%	0.00%	0.00%	NA
Japonica Intermediate	241	59.80%	39.00%	1.24%	0.00%	NA
VI/Aromatic	96	46.90%	53.10%	0.00%	0.00%	NA
Intermediate	90	80.00%	20.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1124114500	T -> A	LOC_Os11g40430-LOC_Os11g40450	intergenic_region ; MODIFIER	silent_mutation	Average:43.45; most accessible tissue: Callus, score: 81.456	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1124114500	NA	5.41E-06	mr1047	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124114500	NA	4.08E-06	mr1088	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124114500	NA	9.37E-06	mr1103	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124114500	NA	1.97E-08	mr1226	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124114500	NA	3.67E-07	mr1411	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124114500	NA	5.46E-06	mr1437	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124114500	NA	7.86E-06	mr1625	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124114500	3.64E-06	7.01E-06	mr1923	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124114500	NA	3.52E-09	mr1070_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124114500	NA	3.37E-08	mr1088_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124114500	NA	1.90E-07	mr1243_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124114500	NA	7.97E-06	mr1246_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124114500	NA	6.59E-06	mr1264_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124114500	NA	5.06E-09	mr1620_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251