\
| Variant ID: vg1124078519 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 24078519 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CATCAAAATGGTTTCTGGGAGCAGTTTGGGCTTTGAAGCCAGCAGGTACATACAGTACCATGATAAGCAATTTGACACTGTGTATGCCTTTTGAAGCTCA[C/T]
CTGTAAGAGCTTTTTCATCCACCAGAAACGATGATAATCTTGACATTGTTGTTAAGTTGATTTTATGGTCATTGGCAAGCTTGATCTCACATAGGCTTGT
ACAAGCCTATGTGAGATCAAGCTTGCCAATGACCATAAAATCAACTTAACAACAATGTCAAGATTATCATCGTTTCTGGTGGATGAAAAAGCTCTTACAG[G/A]
TGAGCTTCAAAAGGCATACACAGTGTCAAATTGCTTATCATGGTACTGTATGTACCTGCTGGCTTCAAAGCCCAAACTGCTCCCAGAAACCATTTTGATG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 37.70% | 17.80% | 1.02% | 43.50% | NA |
| All Indica | 2759 | 32.70% | 2.90% | 1.45% | 62.92% | NA |
| All Japonica | 1512 | 45.80% | 40.70% | 0.46% | 13.03% | NA |
| Aus | 269 | 23.40% | 45.00% | 0.37% | 31.23% | NA |
| Indica I | 595 | 4.70% | 2.20% | 1.68% | 91.43% | NA |
| Indica II | 465 | 26.70% | 2.40% | 1.29% | 69.68% | NA |
| Indica III | 913 | 54.70% | 1.00% | 0.88% | 43.48% | NA |
| Indica Intermediate | 786 | 32.10% | 6.00% | 2.04% | 59.92% | NA |
| Temperate Japonica | 767 | 39.10% | 53.30% | 0.39% | 7.17% | NA |
| Tropical Japonica | 504 | 52.80% | 33.50% | 0.40% | 13.29% | NA |
| Japonica Intermediate | 241 | 52.70% | 15.40% | 0.83% | 31.12% | NA |
| VI/Aromatic | 96 | 86.50% | 1.00% | 0.00% | 12.50% | NA |
| Intermediate | 90 | 44.40% | 25.60% | 0.00% | 30.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1124078519 | C -> T | LOC_Os11g40390.1 | missense_variant ; p.Gly226Asp; MODERATE | nonsynonymous_codon ; G226D | Average:14.703; most accessible tissue: Callus, score: 80.918 | unknown | unknown | TOLERATED | 1.00 |
| vg1124078519 | C -> DEL | LOC_Os11g40390.1 | N | frameshift_variant | Average:14.703; most accessible tissue: Callus, score: 80.918 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1124078519 | 3.55E-06 | 2.03E-06 | mr1050_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124078519 | 5.62E-07 | 5.90E-07 | mr1131_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124078519 | 2.79E-07 | 7.68E-07 | mr1199_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124078519 | 2.77E-06 | NA | mr1208_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124078519 | NA | 2.94E-06 | mr1212_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124078519 | 7.44E-06 | 4.13E-06 | mr1272_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124078519 | NA | 2.69E-06 | mr1407_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124078519 | 1.12E-06 | 3.29E-07 | mr1609_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124078519 | 1.52E-06 | NA | mr1763_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124078519 | 6.26E-07 | 6.26E-07 | mr1852_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124078519 | 3.22E-06 | 3.22E-06 | mr1853_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124078519 | NA | 6.90E-06 | mr1888_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124078519 | 2.33E-07 | 5.03E-07 | mr1909_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124078519 | NA | 9.37E-06 | mr1942_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |