Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124078478:

Variant ID: vg1124078478 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 24078478
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:

TCATGAGCACACTGAACAGCATCTTGAAAGGCCTTCTTGGACATCAAAATGGTTTCTGGGAGCAGTTTGGGCTTTGAAGCCAGCAGGTACATACAGTACC[A/G]
TGATAAGCAATTTGACACTGTGTATGCCTTTTGAAGCTCACCTGTAAGAGCTTTTTCATCCACCAGAAACGATGATAATCTTGACATTGTTGTTAAGTTG

Reverse complement sequence

CAACTTAACAACAATGTCAAGATTATCATCGTTTCTGGTGGATGAAAAAGCTCTTACAGGTGAGCTTCAAAAGGCATACACAGTGTCAAATTGCTTATCA[T/C]
GGTACTGTATGTACCTGCTGGCTTCAAAGCCCAAACTGCTCCCAGAAACCATTTTGATGTCCAAGAAGGCCTTTCAAGATGCTGTTCAGTGTGCTCATGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	37.90%	17.70%	0.93%	43.55%	NA
All Indica	2759	32.90%	2.80%	1.27%	63.03%	NA
All Japonica	1512	45.90%	40.60%	0.40%	13.10%	NA
Aus	269	23.40%	45.00%	1.12%	30.48%	NA
Indica I	595	4.90%	2.40%	1.51%	91.26%	NA
Indica II	465	26.50%	1.70%	1.08%	70.75%	NA
Indica III	913	54.90%	1.20%	0.77%	43.15%	NA
Indica Intermediate	786	32.60%	5.50%	1.78%	60.18%	NA
Temperate Japonica	767	39.20%	53.20%	0.13%	7.43%	NA
Tropical Japonica	504	52.80%	33.50%	0.60%	13.10%	NA
Japonica Intermediate	241	52.70%	15.40%	0.83%	31.12%	NA
VI/Aromatic	96	86.50%	1.00%	0.00%	12.50%	NA
Intermediate	90	44.40%	25.60%	0.00%	30.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1124078478	A -> DEL	LOC_Os11g40390.1	N	frameshift_variant	Average:16.794; most accessible tissue: Callus, score: 80.918	N	N	N	N
vg1124078478	A -> G	LOC_Os11g40390.1	missense_variant ; p.Trp240Arg; MODERATE	nonsynonymous_codon ; W240R	Average:16.794; most accessible tissue: Callus, score: 80.918	probably damaging	-3.395	TOLERATED	1.00

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1124078478	NA	8.96E-06	mr1050_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124078478	3.43E-07	3.33E-07	mr1131_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124078478	1.10E-07	3.16E-07	mr1199_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124078478	7.54E-06	NA	mr1206_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124078478	NA	4.49E-06	mr1212_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124078478	6.75E-06	3.30E-06	mr1272_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124078478	7.24E-06	7.24E-06	mr1353_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124078478	2.77E-06	7.70E-06	mr1402_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124078478	NA	8.30E-07	mr1407_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124078478	8.22E-06	8.22E-06	mr1573_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124078478	8.11E-06	NA	mr1595_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124078478	9.33E-06	9.33E-06	mr1596_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124078478	2.37E-06	4.73E-07	mr1609_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124078478	1.30E-06	9.06E-06	mr1763_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124078478	8.14E-06	NA	mr1767_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124078478	1.92E-07	1.92E-07	mr1852_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124078478	9.44E-07	9.44E-07	mr1853_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124078478	NA	8.78E-06	mr1888_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124078478	5.69E-08	1.09E-07	mr1909_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124078478	3.63E-06	3.23E-06	mr1921_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124078478	2.42E-06	1.93E-06	mr1942_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251