\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124078257:

Variant ID: vg1124078257 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 24078257
Reference Allele: AAlternative Allele: G,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGGGAGCAATGTGCACAAGCAAGTGAACCCACACATCAGATAGGATCTCCCAACGACATTTTTGGTCCTCCTTCTTGATGAGTTCATTAGCCAGTATAGC[A/G,T]
CCTTGTTGCAATATGTTTCCACTCAGATTTAGACCATGCGTACCTTGAACAAGAGCTTTCTGCGCCTCTTTCATAAGCTTGTTGTATATGCTCTGCCAGG

Reverse complement sequence

CCTGGCAGAGCATATACAACAAGCTTATGAAAGAGGCGCAGAAAGCTCTTGTTCAAGGTACGCATGGTCTAAATCTGAGTGGAAACATATTGCAACAAGG[T/C,A]
GCTATACTGGCTAATGAACTCATCAAGAAGGAGGACCAAAAATGTCGTTGGGAGATCCTATCTGATGTGTGGGTTCACTTGCTTGTGCACATTGCTCCCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.80% 17.70% 0.78% 43.72% NA
All Indica  2759 32.90% 2.90% 1.05% 63.18% NA
All Japonica  1512 45.90% 40.50% 0.26% 13.36% NA
Aus  269 23.40% 44.60% 1.49% 30.48% NA
Indica I  595 5.00% 2.50% 1.34% 91.09% NA
Indica II  465 26.70% 1.70% 1.08% 70.54% NA
Indica III  913 54.80% 1.10% 0.33% 43.81% NA
Indica Intermediate  786 32.20% 6.00% 1.65% 60.18% NA
Temperate Japonica  767 39.20% 53.10% 0.39% 7.30% NA
Tropical Japonica  504 52.80% 33.30% 0.00% 13.89% NA
Japonica Intermediate  241 52.70% 15.40% 0.41% 31.54% NA
VI/Aromatic  96 86.50% 1.00% 0.00% 12.50% NA
Intermediate  90 44.40% 25.60% 0.00% 30.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1124078257 A -> T LOC_Os11g40390.1 synonymous_variant ; p.Gly313Gly; LOW N Average:18.892; most accessible tissue: Callus, score: 82.607 N N N N
vg1124078257 A -> T LOC_Os11g40380.1 upstream_gene_variant ; 2636.0bp to feature; MODIFIER N Average:18.892; most accessible tissue: Callus, score: 82.607 N N N N
vg1124078257 A -> DEL LOC_Os11g40390.1 N frameshift_variant Average:18.892; most accessible tissue: Callus, score: 82.607 N N N N
vg1124078257 A -> G LOC_Os11g40390.1 synonymous_variant ; p.Gly313Gly; LOW synonymous_codon Average:18.892; most accessible tissue: Callus, score: 82.607 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1124078257 5.49E-06 NA mr1040_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124078257 4.82E-06 8.82E-06 mr1058_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124078257 5.21E-06 NA mr1131_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124078257 3.92E-06 NA mr1199_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124078257 3.07E-06 9.64E-06 mr1206_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124078257 NA 2.81E-06 mr1407_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124078257 6.63E-06 NA mr1521_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124078257 6.46E-06 4.26E-06 mr1595_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124078257 8.04E-06 NA mr1607_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124078257 1.38E-06 3.51E-07 mr1609_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124078257 3.10E-06 3.10E-06 mr1703_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124078257 9.45E-07 5.66E-06 mr1763_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124078257 1.21E-08 1.21E-08 mr1852_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124078257 6.67E-06 6.67E-06 mr1853_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124078257 9.43E-06 9.44E-06 mr1869_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124078257 5.05E-06 9.68E-06 mr1906_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124078257 7.58E-07 1.16E-06 mr1909_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124078257 7.04E-06 9.70E-06 mr1942_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124078257 8.29E-07 NA mr1959_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251