\
| Variant ID: vg1124078197 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 24078197 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TGACGGTTACGAACTCGACACCGGATTTGAGGTCCTCGGCAAGAGCTGCTGCGTCAGAACTGGGAGCAATGTGCACAAGCAAGTGAACCCACACATCAGA[T/A]
AGGATCTCCCAACGACATTTTTGGTCCTCCTTCTTGATGAGTTCATTAGCCAGTATAGCACCTTGTTGCAATATGTTTCCACTCAGATTTAGACCATGCG
CGCATGGTCTAAATCTGAGTGGAAACATATTGCAACAAGGTGCTATACTGGCTAATGAACTCATCAAGAAGGAGGACCAAAAATGTCGTTGGGAGATCCT[A/T]
TCTGATGTGTGGGTTCACTTGCTTGTGCACATTGCTCCCAGTTCTGACGCAGCAGCTCTTGCCGAGGACCTCAAATCCGGTGTCGAGTTCGTAACCGTCA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 37.70% | 17.80% | 0.72% | 43.78% | NA |
| All Indica | 2759 | 32.80% | 3.00% | 1.05% | 63.14% | NA |
| All Japonica | 1512 | 45.80% | 40.50% | 0.20% | 13.49% | NA |
| Aus | 269 | 23.40% | 44.60% | 0.74% | 31.23% | NA |
| Indica I | 595 | 4.90% | 3.20% | 0.84% | 91.09% | NA |
| Indica II | 465 | 26.90% | 2.20% | 0.43% | 70.54% | NA |
| Indica III | 913 | 54.90% | 1.00% | 0.88% | 43.26% | NA |
| Indica Intermediate | 786 | 31.90% | 5.60% | 1.78% | 60.69% | NA |
| Temperate Japonica | 767 | 39.20% | 52.90% | 0.26% | 7.56% | NA |
| Tropical Japonica | 504 | 52.60% | 33.50% | 0.00% | 13.89% | NA |
| Japonica Intermediate | 241 | 52.70% | 15.40% | 0.41% | 31.54% | NA |
| VI/Aromatic | 96 | 86.50% | 1.00% | 0.00% | 12.50% | NA |
| Intermediate | 90 | 42.20% | 27.80% | 0.00% | 30.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1124078197 | T -> A | LOC_Os11g40390.1 | synonymous_variant ; p.Leu333Leu; LOW | synonymous_codon | Average:19.417; most accessible tissue: Callus, score: 82.607 | N | N | N | N |
| vg1124078197 | T -> DEL | LOC_Os11g40390.1 | N | frameshift_variant | Average:19.417; most accessible tissue: Callus, score: 82.607 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1124078197 | NA | 7.70E-06 | mr1050_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124078197 | 6.94E-06 | NA | mr1088_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124078197 | 7.12E-06 | NA | mr1199_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124078197 | 3.22E-06 | NA | mr1246_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124078197 | 7.13E-06 | 3.36E-06 | mr1272_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124078197 | 7.38E-06 | 4.28E-06 | mr1595_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124078197 | NA | 3.19E-06 | mr1600_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124078197 | 1.95E-06 | 2.88E-06 | mr1607_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124078197 | 8.72E-06 | NA | mr1763_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124078197 | 1.85E-06 | 1.85E-06 | mr1852_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124078197 | NA | 5.53E-06 | mr1888_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124078197 | 5.64E-06 | NA | mr1909_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |