\
| Variant ID: vg1124078152 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 24078152 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ATAATTTGCTCTTCTCGATGCCACAGTGGCAAAACAAAGCCCAGATGACGGTTACGAACTCGACACCGGATTTGAGGTCCTCGGCAAGAGCTGCTGCGTC[A/G]
GAACTGGGAGCAATGTGCACAAGCAAGTGAACCCACACATCAGATAGGATCTCCCAACGACATTTTTGGTCCTCCTTCTTGATGAGTTCATTAGCCAGTA
TACTGGCTAATGAACTCATCAAGAAGGAGGACCAAAAATGTCGTTGGGAGATCCTATCTGATGTGTGGGTTCACTTGCTTGTGCACATTGCTCCCAGTTC[T/C]
GACGCAGCAGCTCTTGCCGAGGACCTCAAATCCGGTGTCGAGTTCGTAACCGTCATCTGGGCTTTGTTTTGCCACTGTGGCATCGAGAAGAGCAAATTAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 37.70% | 17.90% | 0.85% | 43.59% | NA |
| All Indica | 2759 | 32.80% | 3.00% | 1.20% | 62.96% | NA |
| All Japonica | 1512 | 45.80% | 40.60% | 0.26% | 13.36% | NA |
| Aus | 269 | 23.40% | 45.00% | 1.12% | 30.48% | NA |
| Indica I | 595 | 4.90% | 2.50% | 1.51% | 91.09% | NA |
| Indica II | 465 | 26.90% | 2.60% | 0.65% | 69.89% | NA |
| Indica III | 913 | 54.90% | 1.10% | 0.66% | 43.37% | NA |
| Indica Intermediate | 786 | 31.90% | 5.90% | 1.91% | 60.31% | NA |
| Temperate Japonica | 767 | 39.20% | 52.90% | 0.39% | 7.43% | NA |
| Tropical Japonica | 504 | 52.40% | 33.70% | 0.00% | 13.89% | NA |
| Japonica Intermediate | 241 | 52.70% | 15.80% | 0.41% | 31.12% | NA |
| VI/Aromatic | 96 | 86.50% | 1.00% | 0.00% | 12.50% | NA |
| Intermediate | 90 | 42.20% | 27.80% | 0.00% | 30.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1124078152 | A -> DEL | LOC_Os11g40390.1 | N | frameshift_variant | Average:17.912; most accessible tissue: Callus, score: 60.197 | N | N | N | N |
| vg1124078152 | A -> G | LOC_Os11g40390.1 | synonymous_variant ; p.Ser348Ser; LOW | synonymous_codon | Average:17.912; most accessible tissue: Callus, score: 60.197 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1124078152 | 6.13E-06 | NA | mr1199_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124078152 | 9.54E-06 | NA | mr1246_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124078152 | NA | 6.02E-06 | mr1400_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124078152 | NA | 8.76E-06 | mr1407_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124078152 | NA | 3.48E-06 | mr1462_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124078152 | 6.64E-06 | NA | mr1521_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124078152 | 9.38E-07 | 8.41E-07 | mr1609_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124078152 | 1.41E-06 | NA | mr1763_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124078152 | 6.12E-06 | NA | mr1767_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124078152 | 1.10E-07 | 1.10E-07 | mr1852_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124078152 | NA | 6.36E-06 | mr1899_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124078152 | 6.00E-06 | NA | mr1906_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124078152 | 1.03E-06 | 3.59E-06 | mr1909_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124078152 | 3.27E-06 | 1.96E-06 | mr1942_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |