\
| Variant ID: vg1124076491 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr11 | Position: 24076491 |
| Reference Allele: A | Alternative Allele: G,ATG |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AAGACTAAAGCGTCATTAAATAGCATTAGCTGATACCAAATGAGGAAGAGAAGGCTGTTTGTGGTGCTTTCTTCCTGGAAGAAGCACTACATCTGCACAT[A/G,ATG]
GTTACCTCAAGCACATCGGCTCTAGCACGACAATGGACTCTCTCCCCCATGTACAAGTCATATCTCTATTGGATGGATGGTTAGACATGGCTAGAGAAGG
CCTTCTCTAGCCATGTCTAACCATCCATCCAATAGAGATATGACTTGTACATGGGGGAGAGAGTCCATTGTCGTGCTAGAGCCGATGTGCTTGAGGTAAC[T/C,CAT]
ATGTGCAGATGTAGTGCTTCTTCCAGGAAGAAAGCACCACAAACAGCCTTCTCTTCCTCATTTGGTATCAGCTAATGCTATTTAATGACGCTTTAGTCTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 37.70% | 17.50% | 0.55% | 44.27% | NA |
| All Indica | 2759 | 32.70% | 2.60% | 0.72% | 64.04% | NA |
| All Japonica | 1512 | 45.90% | 40.30% | 0.26% | 13.49% | NA |
| Aus | 269 | 23.80% | 44.60% | 0.37% | 31.23% | NA |
| Indica I | 595 | 4.70% | 2.20% | 0.84% | 92.27% | NA |
| Indica II | 465 | 26.20% | 1.90% | 0.65% | 71.18% | NA |
| Indica III | 913 | 54.70% | 0.80% | 0.22% | 44.36% | NA |
| Indica Intermediate | 786 | 32.10% | 5.30% | 1.27% | 61.32% | NA |
| Temperate Japonica | 767 | 39.40% | 52.90% | 0.26% | 7.43% | NA |
| Tropical Japonica | 504 | 52.60% | 33.30% | 0.20% | 13.89% | NA |
| Japonica Intermediate | 241 | 52.70% | 14.90% | 0.41% | 31.95% | NA |
| VI/Aromatic | 96 | 85.40% | 2.10% | 0.00% | 12.50% | NA |
| Intermediate | 90 | 45.60% | 25.60% | 1.11% | 27.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1124076491 | A -> ATG | LOC_Os11g40380.1 | upstream_gene_variant ; 871.0bp to feature; MODIFIER | N | Average:27.4; most accessible tissue: Callus, score: 84.149 | N | N | N | N |
| vg1124076491 | A -> ATG | LOC_Os11g40390.1 | downstream_gene_variant ; 1210.0bp to feature; MODIFIER | N | Average:27.4; most accessible tissue: Callus, score: 84.149 | N | N | N | N |
| vg1124076491 | A -> ATG | LOC_Os11g40380-LOC_Os11g40390 | intergenic_region ; MODIFIER | N | Average:27.4; most accessible tissue: Callus, score: 84.149 | N | N | N | N |
| vg1124076491 | A -> DEL | N | N | silent_mutation | Average:27.4; most accessible tissue: Callus, score: 84.149 | N | N | N | N |
| vg1124076491 | A -> G | LOC_Os11g40380.1 | upstream_gene_variant ; 870.0bp to feature; MODIFIER | silent_mutation | Average:27.4; most accessible tissue: Callus, score: 84.149 | N | N | N | N |
| vg1124076491 | A -> G | LOC_Os11g40390.1 | downstream_gene_variant ; 1211.0bp to feature; MODIFIER | silent_mutation | Average:27.4; most accessible tissue: Callus, score: 84.149 | N | N | N | N |
| vg1124076491 | A -> G | LOC_Os11g40380-LOC_Os11g40390 | intergenic_region ; MODIFIER | silent_mutation | Average:27.4; most accessible tissue: Callus, score: 84.149 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1124076491 | 1.25E-06 | 2.16E-07 | mr1050_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124076491 | NA | 5.89E-06 | mr1272_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124076491 | NA | 2.53E-06 | mr1407_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124076491 | NA | 9.30E-06 | mr1609_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |