Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124076491:

Variant ID: vg1124076491 (JBrowse)	Variation Type: INDEL
Chromosome: chr11	Position: 24076491
Reference Allele: A	Alternative Allele: G,ATG
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAGACTAAAGCGTCATTAAATAGCATTAGCTGATACCAAATGAGGAAGAGAAGGCTGTTTGTGGTGCTTTCTTCCTGGAAGAAGCACTACATCTGCACAT[A/G,ATG]
GTTACCTCAAGCACATCGGCTCTAGCACGACAATGGACTCTCTCCCCCATGTACAAGTCATATCTCTATTGGATGGATGGTTAGACATGGCTAGAGAAGG

Reverse complement sequence

CCTTCTCTAGCCATGTCTAACCATCCATCCAATAGAGATATGACTTGTACATGGGGGAGAGAGTCCATTGTCGTGCTAGAGCCGATGTGCTTGAGGTAAC[T/C,CAT]
ATGTGCAGATGTAGTGCTTCTTCCAGGAAGAAAGCACCACAAACAGCCTTCTCTTCCTCATTTGGTATCAGCTAATGCTATTTAATGACGCTTTAGTCTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	37.70%	17.50%	0.55%	44.27%	NA
All Indica	2759	32.70%	2.60%	0.72%	64.04%	NA
All Japonica	1512	45.90%	40.30%	0.26%	13.49%	NA
Aus	269	23.80%	44.60%	0.37%	31.23%	NA
Indica I	595	4.70%	2.20%	0.84%	92.27%	NA
Indica II	465	26.20%	1.90%	0.65%	71.18%	NA
Indica III	913	54.70%	0.80%	0.22%	44.36%	NA
Indica Intermediate	786	32.10%	5.30%	1.27%	61.32%	NA
Temperate Japonica	767	39.40%	52.90%	0.26%	7.43%	NA
Tropical Japonica	504	52.60%	33.30%	0.20%	13.89%	NA
Japonica Intermediate	241	52.70%	14.90%	0.41%	31.95%	NA
VI/Aromatic	96	85.40%	2.10%	0.00%	12.50%	NA
Intermediate	90	45.60%	25.60%	1.11%	27.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1124076491	A -> ATG	LOC_Os11g40380.1	upstream_gene_variant ; 871.0bp to feature; MODIFIER	N	Average:27.4; most accessible tissue: Callus, score: 84.149	N	N	N	N
vg1124076491	A -> ATG	LOC_Os11g40390.1	downstream_gene_variant ; 1210.0bp to feature; MODIFIER	N	Average:27.4; most accessible tissue: Callus, score: 84.149	N	N	N	N
vg1124076491	A -> ATG	LOC_Os11g40380-LOC_Os11g40390	intergenic_region ; MODIFIER	N	Average:27.4; most accessible tissue: Callus, score: 84.149	N	N	N	N
vg1124076491	A -> DEL	N	N	silent_mutation	Average:27.4; most accessible tissue: Callus, score: 84.149	N	N	N	N
vg1124076491	A -> G	LOC_Os11g40380.1	upstream_gene_variant ; 870.0bp to feature; MODIFIER	silent_mutation	Average:27.4; most accessible tissue: Callus, score: 84.149	N	N	N	N
vg1124076491	A -> G	LOC_Os11g40390.1	downstream_gene_variant ; 1211.0bp to feature; MODIFIER	silent_mutation	Average:27.4; most accessible tissue: Callus, score: 84.149	N	N	N	N
vg1124076491	A -> G	LOC_Os11g40380-LOC_Os11g40390	intergenic_region ; MODIFIER	silent_mutation	Average:27.4; most accessible tissue: Callus, score: 84.149	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1124076491	1.25E-06	2.16E-07	mr1050_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124076491	NA	5.89E-06	mr1272_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124076491	NA	2.53E-06	mr1407_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124076491	NA	9.30E-06	mr1609_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251