\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124076491:

Variant ID: vg1124076491 (JBrowse)Variation Type: INDEL
Chromosome: chr11Position: 24076491
Reference Allele: AAlternative Allele: G,ATG
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAGACTAAAGCGTCATTAAATAGCATTAGCTGATACCAAATGAGGAAGAGAAGGCTGTTTGTGGTGCTTTCTTCCTGGAAGAAGCACTACATCTGCACAT[A/G,ATG]
GTTACCTCAAGCACATCGGCTCTAGCACGACAATGGACTCTCTCCCCCATGTACAAGTCATATCTCTATTGGATGGATGGTTAGACATGGCTAGAGAAGG

Reverse complement sequence

CCTTCTCTAGCCATGTCTAACCATCCATCCAATAGAGATATGACTTGTACATGGGGGAGAGAGTCCATTGTCGTGCTAGAGCCGATGTGCTTGAGGTAAC[T/C,CAT]
ATGTGCAGATGTAGTGCTTCTTCCAGGAAGAAAGCACCACAAACAGCCTTCTCTTCCTCATTTGGTATCAGCTAATGCTATTTAATGACGCTTTAGTCTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.70% 17.50% 0.55% 44.27% NA
All Indica  2759 32.70% 2.60% 0.72% 64.04% NA
All Japonica  1512 45.90% 40.30% 0.26% 13.49% NA
Aus  269 23.80% 44.60% 0.37% 31.23% NA
Indica I  595 4.70% 2.20% 0.84% 92.27% NA
Indica II  465 26.20% 1.90% 0.65% 71.18% NA
Indica III  913 54.70% 0.80% 0.22% 44.36% NA
Indica Intermediate  786 32.10% 5.30% 1.27% 61.32% NA
Temperate Japonica  767 39.40% 52.90% 0.26% 7.43% NA
Tropical Japonica  504 52.60% 33.30% 0.20% 13.89% NA
Japonica Intermediate  241 52.70% 14.90% 0.41% 31.95% NA
VI/Aromatic  96 85.40% 2.10% 0.00% 12.50% NA
Intermediate  90 45.60% 25.60% 1.11% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1124076491 A -> ATG LOC_Os11g40380.1 upstream_gene_variant ; 871.0bp to feature; MODIFIER N Average:27.4; most accessible tissue: Callus, score: 84.149 N N N N
vg1124076491 A -> ATG LOC_Os11g40390.1 downstream_gene_variant ; 1210.0bp to feature; MODIFIER N Average:27.4; most accessible tissue: Callus, score: 84.149 N N N N
vg1124076491 A -> ATG LOC_Os11g40380-LOC_Os11g40390 intergenic_region ; MODIFIER N Average:27.4; most accessible tissue: Callus, score: 84.149 N N N N
vg1124076491 A -> DEL N N silent_mutation Average:27.4; most accessible tissue: Callus, score: 84.149 N N N N
vg1124076491 A -> G LOC_Os11g40380.1 upstream_gene_variant ; 870.0bp to feature; MODIFIER silent_mutation Average:27.4; most accessible tissue: Callus, score: 84.149 N N N N
vg1124076491 A -> G LOC_Os11g40390.1 downstream_gene_variant ; 1211.0bp to feature; MODIFIER silent_mutation Average:27.4; most accessible tissue: Callus, score: 84.149 N N N N
vg1124076491 A -> G LOC_Os11g40380-LOC_Os11g40390 intergenic_region ; MODIFIER silent_mutation Average:27.4; most accessible tissue: Callus, score: 84.149 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1124076491 1.25E-06 2.16E-07 mr1050_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124076491 NA 5.89E-06 mr1272_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124076491 NA 2.53E-06 mr1407_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124076491 NA 9.30E-06 mr1609_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251